1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hodyreva [135]
3 years ago
6

Which statements about waves are true? (Select TWO)

Biology
1 answer:
bulgar [2K]3 years ago
6 0

Answer:

F

Explanation:

You might be interested in
1. Every human body has an uncountable number of this basic unit of a muscle known as the: (1 point)
navik [9.2K]
1: <span> muscle fibers 
2: </span><span> Endurance activities
</span>3: <span> a motor unit 
4: </span><span> All or none principal 
5: </span><span>Striated muscles
6: </span><span>Smooth muscles 
7: </span><span> Cardiac muscles
</span>
4 0
4 years ago
Read 2 more answers
Need urgently. Due tomorrow
Tpy6a [65]

Answer:

The London’s numbers are more than twice the amount compared to the the East and west .

East’s cases increase higher and higher while west’s cases change from 3-6

Explanation:

4 0
4 years ago
The _______ is the layer of the atmosphere in which weather occurs. A. Thermosphere B. Exosphere C. Mesosphere D. Troposphere
navik [9.2K]

this is the  Troposphere

8 0
3 years ago
Read 2 more answers
Review 2
GREYUIT [131]
1) True
2) False
3) False
4) True
5) True
6) True
7) True
8) True
8 0
2 years ago
Which of these invertebrates have segmented bodies.?
zhuklara [117]

<u>Answer:</u>

The correct answer option is C. Annelids.

<u>Explanation:</u>

Annelids are the invertebrates that have segmented bodies.

The annelids or Phylum Annelida (also called ringed or segmented worms) are widely known for their characteristic of having segmented bodies.

These annelids contain largely segmented bodies with each segment having secondary subdivisions known as annuli which consists of elements of the different body systems which are essential for life, for instance the nervous system.

7 0
3 years ago
Other questions:
  • Explain how living things such as people and trees are different from none living things such as rocks and the tent?
    5·1 answer
  • What are the final products (or "outputs") of the citric acid cycle?
    11·1 answer
  • Please I need help!!
    8·1 answer
  • How do plants engage in transpiration?
    7·2 answers
  • In this phase the chromosones begein to un coil and form chromatin?
    10·1 answer
  • What conditions can lead to severe wild fires
    8·2 answers
  • A protozoan that divides to form two daughter cells just like itself would be undergoing _____.
    9·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Question 4 of 10 When you remember something because it has meaning for you, you are using:
    13·1 answer
  • Please help quick due soon!
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!