4 years ago

Which cells are required to process and present antigens from foreign material as the initial step in the immune response?

1 answer:

6 0

The macrophage is the cell responsible for detecting, engulfing and destroying pathogens and apoptotic cells. These cells process and present antigens (foreign materials) to immunocompetent cells and thus they are the key mediators in the development of all immune reactions.

You might be interested in

Describe the two characteristics that dna needs to fulfill its role as a genetic material?

nataly862011 [7]

The DNA has to code for a protein and it has to replicate

6 0

3 years ago

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

marysya [2.9K]

It should be
AGATACCATGGTTACCCGGTTCCA

6 0

3 years ago

Classify each group of fungi based on their reproductive structures and behavior.

spayn [35]

Answer:

The answer is.......

Explanation: (Just took test) The first drop down is club fungi The second drop down is chytrids The third drop down is zygote fungi and The fourth drop down is sac fungi .

7 0

3 years ago

What would most likely occur over time if the burning and clearing of tropical rainforests stopped?

larisa [96]

The concentration of carbon dioxide in the atmosphere will decrease over time as it will be stored in the trees instead.

6 0

3 years ago

Read 2 more answers

The written notation used to represent the elements a compound contains and the relative number of atoms of each element is call

Anni [7]

Sorry I want points

7 0

3 years ago