1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Step2247 [10]
3 years ago
11

Within eukaryotic cells, energy is derived from the breaking down of glucose. What is this process called?

Biology
1 answer:
lorasvet [3.4K]3 years ago
6 0

Answer:

C

Explanation:

You might be interested in
1. Suppose a dominant allele (N) codes for a big nose and a recessive allele (n) codes for a small nose. Imagine that an organis
Tcecarenko [31]
NN would be it's genotype and big nose would be it's phenotype.
8 0
3 years ago
Which are classified as sac fungi?
Vinvika [58]
The answer is: A - truffles, morels, yeast
4 0
2 years ago
The Earth's seasons affect only the way plants grow and change.
Black_prince [1.1K]

Answer:

yes but it can also affect humans like tornadoes destroying homes?

6 0
3 years ago
When ATP loses a phosphate, energy is released ________ and is formed.<br> What is the blank??
Alexus [3.1K]

When ATP loses a phosphate, energy is released and ADP is formed



5 0
4 years ago
Read 2 more answers
In the area near an old copper mine,no plant grow. Go further away more and more plants are growing. An analysis of the soil nea
maks197457 [2]

Plants do not grow near the old copper mine because of the excess copper deposited in them impairs cellular processes and inhibits plant growth.

What are micronutrients?

These are required by plants in much smaller quantities less than 1% of the dry weight but are necessary for growth and development. There are 7 essential plant nutrients like boron (B), zinc (Zn), manganese (Mn), iron (Fe), copper (Cu), molybdenum (Mo), and, chlorine (Cl).

Copper activates some enzymes in plants that are involved in lignin synthesis and are required in the process of photosynthesis.

Excess copper causes reduced seed germination, low shoot vigour, and lower iron availability. A deficiency of copper can lead to increased to susceptibility to diseases like ergot, which can cause significant loss in the yield.

Plants growing in the old copper mine have the excess deposition of copper in one place which affects the germination of seeds hence it is found difficult to grow in the old copper mine.

Plants can grow easily in a place that is further away from the old copper mine. Because there is a high concentration of copper dissolved in water in the soil, this helps the plant to grow by exhibiting the photosynthesis process.

Learn more about micronutrients from the link given below:

brainly.com/question/7411332

#SPJ1

6 0
1 year ago
Other questions:
  • Which type of stress causes deformation that leads to earthquakes at converging plate boundaries
    8·1 answer
  • Which term describes the way an organism responds to stimuli?
    6·2 answers
  • A shark with a tail as long as its body would likely swim _________ than a shark with a crescent shaped tail.
    5·1 answer
  • You are monitoring the results of laboratory tests performed on a client admitted to the cardiac icu with a diagnosis of myocard
    11·1 answer
  • Which phrase best defines a galaxy?
    10·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Explain what happens to the incoming solar radiation on a cloudy day, and how this affects the temperature at Earth's surface.
    9·1 answer
  • Help me on this please
    8·1 answer
  • The flow of energy and matter through an ecosystem may be compared to a waterwheel in a river.How is this comparison accurate?Ho
    6·1 answer
  • Write a claim indicating which type of beak has an adaptive advantage in Geospiza fortis during a drought. Next, provide evidenc
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!