1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
7

Which statement correctly indefinites the role of gases in the two processes

Biology
1 answer:
Ann [662]3 years ago
3 0

Answer:

what are the options?

Explanation:

lmk or dont

You might be interested in
Meiosis involves __ cell divisions.<br><br>2,3 or 4 ?<br><br>​
Alexxx [7]
Answer:
2 cell divisions
6 0
3 years ago
Read 2 more answers
Based on the information presented in the passage, which of the following conclusions can the reader make?
Oxana [17]

Answer:

B . Knowing the climate makes it easy to predict the weather.

C . If it is cold today, you almost certainly live in a cold climate.

D . Weather can change quickly, but climate changes slowly.

Explanation:

If we know the climate of a particular region we can predict the weather of the next day or week of that region because climate is remain the same of a specific region. If the weather is cold it means that you live in a cold climate, similarly, if the weather is warm it means the climate of that region is warm and hot. Weather can change and has high variations whereas climate is the average atmospheric conditions of a region for a long period of time.

6 0
3 years ago
After the experiment,scientists organize and _the data?
telo118 [61]

The experiment is the procedure performed to prove a hypothesis. The researchers perform an experiment, which can provide data to prove, if the hypothesis suggested is true or not.

After conduction of the experiment several times, the researchers collect all the data and organize it. After organization of the data properly, they analyze the data collected, so that they can formulate, if the hypothesis is true or not.

Hence, the given blank can be filled with Analyze.

6 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
5. Which of the following result in protein?
ludmilkaskok [199]

Answer:

The answer to your question is B.

8 0
2 years ago
Other questions:
  • A population of arctic hares burrows into the snow for shelter. It is found
    8·1 answer
  • plz help!!!! A nucleotide consists of all of the following except: sugar nitrogenous base lipid phosphate group
    11·1 answer
  • How do animals in the surface zone keep from sinking?
    14·1 answer
  • How is magma generated along convergent plate boundaries?
    6·1 answer
  • Which characteristics of fish might allow them to survive?
    12·2 answers
  • Waht type of information is recorded ina trace fossil
    14·1 answer
  • Which of the following biological processes occurs in a cells mitochondria A.protein digestion
    11·2 answers
  • Please help with the answer
    7·1 answer
  • Match each organism with the type of association it exhibits.
    14·1 answer
  • What is the main driving force for surface ocean currents?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!