1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
12

Compare photosynthesis with cellular respiration State and explain at least two points of comparison between these two processes

Biology
2 answers:
weeeeeb [17]3 years ago
8 0
Both involve in production of energy

→ Both involve the exchange of gases

→ Both the process takes place in cell organelle which was considered as endosymbiotic organism. They are chloroplast and Mitochondria, Photosynthesis takes place in Chloroplast where as respiration takes place in mitochondria.

→ At critical condition both have alternate pathway.

timama [110]3 years ago
4 0
  • Both the process produces energy
  • Gaseous exchange occurs in both the reaction
  • Both processes occur in cell organelle.
  • The substrate is different both the reaction

Further Explanation:

The photosynthesis reaction mainly occurs in Chloroplast, and cellular respiration occurs in mitochondria and cytoplasm. Photosynthesis is an anabolic process. Photosynthesis is a process by which glucose and oxygen are produced with the help of carbon dioxide, water, and sunlight.

\text{6CO}_{2}+\text{6H}_{2}\text{O}\rightarrow\text{C}_6\text{H}_{12}\text{O}_6+\text{6O}_2+\text{CHEMICAL ENERGY +ATP}

Photosynthesis starts with the absorption of the light or solar energy by the plant pigments called chlorophyll. The activated chlorophyll molecule helps in the electron transfer from one acceptor to another, forming a chain. Mainly photosynthesis occurs in the chloroplast of bacteria, algae, and plants.

In the cellular respiration process, animal utilizes glucose and oxygen to produce carbon dioxide and water. Carbon dioxide released by the body is then absorbed by the plant, and then they utilize it as an energy source. So, the cellular respiration process uses glucose to produce energy, and photosynthesis uses sunlight to produce glucose.

\text{C}_6\text{H}_{12}\text{O}_6+\text{6O}_2\rightarrow\text{6CO}_{2}+\text{6H}_{2}\text{O}+\text{CHEMICAL ENERGY +ATP}

Learn more:

  1. Learn more about cell organelle brainly.com/question/5923583
  2. Learn more about the diffusion brainly.com/question/1386629
  3. Learn more about the plant brainly.com/question/862697

Answer Details:

Grade: High School

Subject: Biology

Chapter: Plant Cell

Keywords:

Photosynthesis, light-dependent reaction, dark reaction, energy, chlorophyll, cellular respiration, light-independent reaction, ATP, glucose, carbon dioxide, water.

You might be interested in
Suggest why captopril or other ACE inhibitors might fail to lower a patient's blood pressure?
rjkz [21]

Answer:

Angiotensin-converting enzyme (ACE) inhibitors are commonly prescribed to treat high blood pressure, heart problems and other conditions. Find out how they work and their possible side effects.

Angiotensin-converting enzyme (ACE) inhibitors help relax veins and arteries to reduce blood pressure. ACE inhibitors prevent an enzyme in your body from producing angiotensin II, a substance that narrows your blood vessels. This narrowing can cause high blood pressure and force the heart to work harder. Angiotensin II also releases hormones that raise blood pressure.

In addition to high blood pressure, angiotensin-converting enzyme inhibitors prevent, treat or improve symptoms in conditions such as the following:

Coronary artery disease

Heart failure

Diabetes

Certain chronic kidney diseases

Heart attacks

Scleroderma: a disease that involves hardening of the skin and connective tissues

Migraines

The doctor may prescribe other medications in addition to an angiotensin-converting enzyme inhibitor, such as a diuretic or a calcium antagonist. Angiotensin-converting enzyme inhibitors should not be taken together with angiotensin receptor blockers or with direct renin inhibitors.

Angiotensin-converting enzyme inhibitors work better for younger people than for older people. They also work better for white people than for black people. The doctor may recommend a different medication.

7 0
3 years ago
The most inclusive level of organization encompasses all regions of Earth's crust, waters, and atmosphere and is called the ____
nexus9112 [7]

Answer:

The most inclusive level of organization is called the Biosphere.

Explanation:

The biological level of organization is organized from the simplest(least inclusive) to the most complex(most inclusive)

The Atom is the simplest unit. Two or more atoms will form a molecule.

The molecules come together to form a cell which is the basic functional unit of life. Cells come together to form tissues then organs and the organ system. Together they make an organism

Populations is formed by a group of the same organisms living in the same area.

Different populations will form a community. The communities together with the environment they live in form an Ecosystem.

Lastly, The Biosphere is the most inclusive and encompasses all ecosystems on Earth

5 0
3 years ago
In the life cycle of a moss, the sporophyte remains attached to the __________
Tomtit [17]
The answer is c gametophyte

8 0
3 years ago
Which of the following will lead to speciation? Select one of the options below as your answer. A. Variation in gene pool B. Lac
antoniya [11.8K]
<span>The answer is A. Variation in gene pool
Speciation is a formation of a new species during the evolution line. When there is a variation in a gene pool, a unique combination between genes could be formed during the mating process. This will create an offspring with unique gene pool that will lead to speciation</span>
7 0
3 years ago
Read 2 more answers
What is the body's first line of defense against disease?
KATRIN_1 [288]

Answer:

The first line of defence (or outside defence system) includes physical and chemical barriers that are always ready and prepared to defend the body from infection. These include your skin, tears, mucus, cilia, stomach acid, urine flow, 'friendly' bacteria and white blood cells called neutrophils.

Explanation:

7 0
3 years ago
Other questions:
  • What are the causes of microplastic pollution
    9·1 answer
  • Microalgae
    13·1 answer
  • Give three reasons why flowers are important in our day life​
    15·2 answers
  • What is the outcome of mitosis
    13·2 answers
  • Which phase of mitosis is characterized by each pair of sister chromatids moving to opposite sides of the cell?
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Takkkkeeeeeeee ppooooinnttsssss.....
    8·1 answer
  • 17. The ff. are true of ligands
    8·1 answer
  • 1.) There is a lot of carbon dioxide in the atmosphere, what is the process by which plants remove it from
    14·1 answer
  • Were all ascospores of the same color _____________________ if not, how did the colors become mixed.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!