1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ikadub [295]
2 years ago
13

How are cellular respiration and photosynthesis similar?

Biology
1 answer:
Vadim26 [7]2 years ago
7 0

Answer: B

Explanation:

Each produce food necessary for each organisms.

You might be interested in
Impulse is just a change in? <br> Answer plss
Mila [183]

Answer:

due to the rate of blood circulation

7 0
3 years ago
Read 2 more answers
Use the information from Parts B and C to solve this problem. If a rabbit of genotype AaBb is bred to a rabbit of genotype AaBb,
Kipish [7]

The question is incomplete and the complete question is

Suppose that ear length in rabbits is controlled by two additive genes, each of which has two alleles. A true-breeding female (aabb) with 6-cm ears is mated to a true-breeding male (AABB) with 16-cm ears.

Answer:

AABb or AaBB

Explanation:

We know that,

aabb genotype - 6 cm

AABB genotype- 16-cm

To calculate the length of earlobe contributed by each allele in a genotype is :

1. length of aabb/4 or 6/4= 1.5 cm (a and b contribute for 1.5 cm each)

2. Length of AABB/4 or 16/4= 4 cm (A and B contribute for 4 cm each)

Now to have the earlobe to be 13.5 cm long then the genotype must be

13.5 = 4+4+4+1.5 or A+A+B+b or A+a+B+B

Therefore, the genotype will be-either AABb or AaBB

3 0
3 years ago
Explain what a geographic information system (GIS) is, and describe how a GIS is enabling scientists
yulyashka [42]

Answer:

Explanation:

Geographic Information Systems (GIS) store, analyze and visualize data for geographic positions on Earth’s surface. GIS is a computer-based tool that examines spatial relationships, patterns and trends. By connecting geography with data, GIS better understands data using a geographic context.

5 0
3 years ago
11. Consider the sequence shown, determine the complementary RNA and the amino acids
mezya [45]
ATG, CAT, AAA, CGT, GTG

adenine, thymine, guanine
cytosine, adenine, thymine
adenine
cytosine, guanine, thymine
guanine, thymine

for RNA, you’ll just do the opposite of what the DNA strand says..... so A pairs with T and C pairs with G

for the actual acids, you’ll just list the names of the RNA sequence, which could be adenine, thymine, guanine, or cytosine
8 0
3 years ago
What is the purpose of mucous coating inside the stomach?
Gwar [14]

Answer:

to break down food

Explanation:

and also to absorb nutrients

8 0
3 years ago
Read 2 more answers
Other questions:
  • The formula v2 = G is very useful for astronomers because it does not require them to know T. What does T stand for? orbital per
    15·2 answers
  • Which species is mostly likely a producer?
    15·1 answer
  • Explain the role of enzymes in biochemical reactions
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • You are working in a clinical lab. Two E. coli samples are sent to you for analysis and you are asked to determined whether they
    15·1 answer
  • Heeeeeelp!!!!!!!!!!!!!!
    5·1 answer
  • Will give Brainiest!!! Which statement best describes Mendel’s experiment
    10·2 answers
  • Earthquakes that happen oceans and continents around oceans and down the middle of oceans typically occur in a _ pattern.
    8·1 answer
  • How does pinocytosis work?
    10·1 answer
  • State the trophic level of each of the following: cow: ______________________ grass: _____________________ man: ________________
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!