1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikitadnepr [17]
3 years ago
10

What element is considered to be the element around which life on Earth is based because it forms essential molecules?​

Biology
2 answers:
Arlecino [84]3 years ago
4 0
Carbon is im pretty sure
trapecia [35]3 years ago
3 0
Everything is based on and has Carbon
You might be interested in
Which two systems are used in order for Signals travel down the spinal cord to the muscles
Veseljchak [2.6K]

Answer:

The nervous system provides the link between thoughts and actions by relaying messages that travel so fast you don't even notice. Nerves and muscles, working together as the neuromuscular system, make your body move as you want it to.

Explanation:

4 0
4 years ago
Read 2 more answers
Which of the following best describes the process of diffusion?
sveta [45]
"Diffusion is the movement of molecules from an area of higher concentration to one of lower" is the one among the following choices given in the question that <span>best describes the process of diffusion. The correct option among all the options that are given in the question is the fourth option or the last option.</span>
6 0
4 years ago
Read 2 more answers
. For the following give the mRNA, tRNA and amino acid (a.a.) sequence that will be created:
alexdok [17]
<span>mRNA: UACAUGGCCUUACGCUAA tRNA: AUG UAC CGG AAU GCG AUU a.a: Tyrosine, Methionine, Alanine, Leucine, and Arginine DNA has 4 different bases, they are Adenine (A), cytosine (C), guanine (G), and Thymine (T). RNA also has 4 bases with three of them being identical to the DNA bases and Thymine being replaced with Uracil (U). These bases are generally represented by the 1st letter of their names. Each of the bases will join with a complementary base, so A always pairs with T or U, and C will pair with G. So to create the mRNA, simply replace every A with a U, every C with a G, every G with a C, and finally, every T with a A. So mRNA: UACAUGGCCUUACGCUAA Now for tRNA, there's a slight twist. It only comes in 3 base codons, You won't find a sequence of tRNA other than in 3 base codons. And each of those codons will be uniquely paired with an amino acid. In the ribosomes, the mRNA will be sequentially scanned 3 bases at a time allowing for a matching tRNA sequence to bind to the exposed 3 bases, this will cause the next amino acid to be bound into the protein being constructed. So split the mRNA into 3 base sequences and calculate the complement to get the tRNA. A simple shortcut is to look at the original DNA sequence and simply replace a T bases with U. So tRNA: AUG UAC CGG AAU GCG AUU Notice the spaces every 3rd base. THIS IS REQUIRED. These is no continuous length of tRNA. You'll only find it in 3 base lengths and each of them will be bound with an amino acid. For the amino acid that's coded to the RNA, you'll need to use a lookup table in your text book, or one you can find online. Then it's a simple matter of matching each 3 base sequence to the amino acid. For the sequence given we have: AUG - Tyrosine UAC - Methionine CGG - Alanine AAU - Leucine GCG - Arginine AUU - STOP Notice the AUU doesn't decode to a specific amino acid. It instead indicates to the ribosome to stop the production of the protein. So the amino acid sequence for the originally given DNA sequence is: Tyrosine, Methionine, Alanine, Leucine, and Arginine.</span>
8 0
4 years ago
The main source of energy for our planet is/are
marusya05 [52]
The sun! It's solar radiation heats our planet, gives us light, and sustains life.
6 0
3 years ago
Read 2 more answers
What are two variables in determining climate
Monica [59]
Temperature and precipitation
6 0
3 years ago
Other questions:
  • As it grows from a seed to a mature plant, a plant will grow taller and thicker. Which abiotic factors are responsible for the i
    10·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which statement about cells is true? A)They vary in size but are all the same shape. B)They vary in shape but are all the same s
    15·1 answer
  • Explain two effects that the study of genes could have on the future.
    9·1 answer
  • Life expectancy in Canada continues to steadily increase. By 2021, the life expectancy for a 65-year-old is expected to have inc
    6·2 answers
  • Are these correct if not what is the correct answer <br>​
    12·1 answer
  • Which plant does not contain a nucleus
    6·2 answers
  • Bij welk verbrandingsproces in het lichaam spelen koolstofdioxide , stikstof,zuurstofgas,waterdamp een belangrijke rol?​
    7·1 answer
  • 4. What is soil conservation?<br>​
    15·1 answer
  • PLEASE HELP ANYONE WILL MARK BRAINLIST!!!!!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!