Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Hello. The chart mentioned in the question above is attached just below.
Answer:
A) has increased with increasing human population
Explanation:
As you can see in the graph below, the line that indicates the number of endangered species increases as the line that represents the increase in the human population increases. This means that the number of extinct species has increased with the increase in the human population.
This is because with the increase in the human population, there is a growing need for natural resources, in addition to increasing the need for cities to expand. All of this results in greater deforestation and extraction of natural resources, which ends up causing an increase in the factors responsible for the extinction of animals.
Answer:
Excretion is a process by which metabolic waste is eliminated from an organism.
C) United states
it have the most greenhouse gases