1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pshichka [43]
3 years ago
5

Using a simple aproxamation above,calculate the volume of the right circular cylinder with a radius of 2 meters and a height of

9 m
Biology
1 answer:
OlgaM077 [116]3 years ago
6 0

Answer:

Volume = 113.112 m³

Explanation:

Given the following data;

Radius = 2 meters

Height = 9 meters

To find the volume of a right circular cylinder;

The volume of a right circular cylinder is calculated by multiplying the area of its circular base with the height of the cylinder.

Mathematically, the volume of a right circular cylinder is given by the formula;

Volume= πr²h

Where;

r is the radius of the circular base.

h is the height of the cylinder.

Substituting the values into the formula, we have;

Volume = 3.142 * (2)² * 9

Volume = 3.142 * 4 * 9

Volume = 113.112 m³

You might be interested in
What is an organelle
Basile [38]

Answer:

any of a number of organized or specialized structures within a living cell.

Explanation:

Thanks for letting me help!!

7 0
3 years ago
Read 2 more answers
A cell with six chromosomes undergoes mitosis how many chromosomes does each daughter cell have
Semenov [28]

Answer:

I may be wrong

Explanation:

But they have 46 chromosomes

3 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST
zalisa [80]

Answer:

B. Blood viscosity increases and results in decreased blood flow throughout the body.

hope this helps :D

3 0
3 years ago
What temperature allows for the best solar panel operation ? ​
insens350 [35]

Answer:

I think temperature 25°c / 77° F or lower

Explanation:

how to meant to be wrong

6 0
3 years ago
Please help me answer 2-7 please thank you so much
Hitman42 [59]
The answer to 2-7 would be -5, but 7-2 would be 5, depends how specific one is trying to be. 
3 0
3 years ago
Other questions:
  • Particles closest together in which state of matter
    5·2 answers
  • To study the molecular mechanism of DNA replication, you incubated soluble E. coli extracts with a mixture of dATP, dTTP, dGTP,
    15·1 answer
  • A cancer patient expresses emotional distress to his nurse prior to treatment. the nurse tells the patient that she understands
    10·1 answer
  • How many ATP molecules are spent during one turn of the Calvin cycle?
    14·1 answer
  • How are mountains and plateaus alike?
    10·2 answers
  • The most extensive damage produced by hurricanes that make landfall is done by
    11·2 answers
  • What are two ways rock layers can change after they are deposited horizontally?
    7·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Is it good to remove carbon dioxide from the atmosphere
    10·1 answer
  • TRNA:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!