Ask question

Ask question

All categories

2 years ago

12

Bacteria that can live in extreme environments.

1 answer:

Umnica [9.8K]2 years ago

3 0

Thermophiles................

You might be interested in

A large power plant burns coal to generate electricity for nearby homes and businesses. This contributes most directly to which

tatuchka [14]

Answer:

global warming

Explanation:

4 0

3 years ago

Read 2 more answers

How can an increase in sunspots impact global<br> climate?

MissTica

Ultraviolet radiation may increase when there is an increase in sunspots

4 0

3 years ago

Read 2 more answers

which term refers to the structure that forms the surface of a cell separeting its conctents from the outside world

Deffense [45]

i think it is called a stomata

7 0

2 years ago

Which phrase tells a major function of the endomembrane system?

viktelen [127]

Answer:

A

Explanation:

3 0

2 years ago

What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT

Kazeer [188]

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

8 0

2 years ago

Read 2 more answers