1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pachacha [2.7K]
3 years ago
6

What will happen to a tide pool itself if star fish are removed from the ecosystem?

Biology
1 answer:
ICE Princess25 [194]3 years ago
6 0

Answer:

the ecosystem will be disturbed... the animals feeding on it will be reduced due to lack of food and the animals on which the star fish was feeding will be increased which causes a total imbalance in ecosystem..

You might be interested in
Is often in the news, the opposite extreme can also lead to globa
-Dominant- [34]

Answer:

if you have ah party wen we are pouring for the house and I

3 0
2 years ago
When the baby lies crosswise in the uterus during delivery, this is called?
lys-0071 [83]
It is the transverse position. The child has his make a beeline for one of his mom's sides and the base over her guts at her opposite side. This is typical before 26 weeks. By 29-30 weeks we anticipate that children will be head down or if nothing else breech.
8 0
3 years ago
What are the ACSM recommendations for cardiovascular health?
forsale [732]

Answer:

C. 30 min minutes a day 5 days a week of moderate-intensity exercise or 20 minutes a day 3 days a week of vigorously intense exercise

Explanation:

The combination of aerobic and muscle-strengthening physical activity is crucial for a healthy lifestyle. Regular physical activity can help to reduce the risk of cardiovascular and chronic diseases, disability and premature mortality.  

Adults need a moderate physical aerobic activity for a minimum of 30 minutes 5 days a week or 20 minutes of vigorous-intensity aerobic activity. A combination of these two can be done to achieve this goal.

A moderate-intensity physical activity, like <u>fast walking</u>, should produce a noticeable rise in heart rate and breathing. On the other hand, a vigorous-intensity activity, like <u>running</u>, should produce a large and bigger change in heart rate and breathing.

The muscle-strengthening activity, should be performed for a minimum of 2 days a week on two or more nonconsecutive days.

3 0
3 years ago
What evidence supports Hess's theory of seafloor spreading?
solong [7]

Answer:

Evidence of Sea Floor Spreading Harry Hess’s hypothesis about seafloor spreading had collected several pieces of evidence to support the theory. This evidence was from the investigations of the molten material, seafloor drilling, radiometric age dating and fossil ages, and the magnetic stripes.

Explanation:

(winks and runs off)

7 0
3 years ago
What is the change in the internal energy of a system that does 5,000 joules of work and absorbs 20,000 joules of heat?
Mademuasel [1]

Answer: (B) is the answer no cap

Explanation:

6 0
3 years ago
Other questions:
  • Why do plant cells have different organelles than those found in animal cells?
    8·1 answer
  • A scientific observation is different from a inference. An inference involves a degree of probability that an scientific observa
    12·1 answer
  • Consider this animal cell. mc016-1.jpg What is the function of the organelles that are labeled F? to temporarily store water, wa
    6·2 answers
  • The term semi permeable is used in reference to the
    13·1 answer
  • Which of the following statements best describes what happens during the S phase of the cell cycle?
    7·1 answer
  • Which of the following is an example of a eukaryote? E. coli Amoeba Salmonela
    14·2 answers
  • Polar and tropical regions maintain fairly constant average temperatures because
    10·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • PLSSS HELP ASAP IF YOU TURLY KNOW THIS:)
    5·2 answers
  • What is the main force that drives deep ocean currents?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!