1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lozanna [386]
2 years ago
7

Compare how natural selection selects for organisms with beneficial traits over those with less beneficial traits for an environ

ment.
Biology
1 answer:
gavmur [86]2 years ago
4 0
I don’t have a lot to say I can help but you don’t know what to say to you
You might be interested in
How does the function of a neuron determine the structure ?
Alenkinab [10]

Answer:

Explanation:

While neurons have a lot in common with other types of cells, they're structurally and functionally unique. Specialized projections called axons allow neurons to transmit electrical and chemical signals to other cells. Neurons can also receive these signals via rootlike extensions known as dendrites.v

6 0
2 years ago
Read 2 more answers
A little help guys? Thanks.
Kobotan [32]
B. some species die out when environmental changes occur
8 0
2 years ago
Read 2 more answers
Cells have blank of enzymes to act as biological
koban [17]
Cells have thousands of enzymes to act as biological catalysts.
3 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Which trait is determined by both genetics and the environment?
babymother [125]

Answer:

b

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • "Most populations demonstrate _____ growth, in which the population size increases exponentially until it levels off near the ca
    5·1 answer
  • Yellowstone National Park has an average of about 4500 bison living in it. The park covers 3472 square miles. What is the popula
    5·2 answers
  • In the 1880s, Louis Pasteur developed a method of weakening viruses. The weakened viruses could be injected into healthy individ
    10·1 answer
  • Which of the following elements is required for growth and development and is in our DNA? *
    15·1 answer
  • How does overtillage harm soil
    5·1 answer
  • What are some characteristics of a vertebrate?
    5·1 answer
  • Pairs of genes that control the same trait are known as _____.
    14·1 answer
  • CAN I PLZ HAVE SOME HELP!!!! DUE TO NIGHT<br> choose answer chose (ROW 1 , ROW 2 , ROW 3 , ROW 4)
    13·1 answer
  • Dementia refers to a loss of brain function that usually first appears as forgetfulness. T/F PSYCHOLOGY
    10·1 answer
  • Which statement best explains why each river has its own set of characteristics a river supports different organisms depending o
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!