1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
2 years ago
13

If you add energy to a solid, what change of state might occur?

Biology
1 answer:
crimeas [40]2 years ago
8 0

Answer:  b  It changes from a solid to a liquid

Explanation:

Solid state : In this state, the molecules are arranged in regular and repeating pattern. The molecules are closely packed that means they are fixed and vibrate in place but they can not move from one place to another.

Liquid state : In this state, the molecules are present in random and irregular pattern. The molecules are closely packed but they can move from one place to another.

Gaseous state : In this state, the molecules are present in irregular pattern. The molecules are not closely packed and they can move freely from one place to another and spread out.

In solid the particles are closely packed as the inter molecular forces of attraction are strongest. As energy is added to solids, the kinetic energy of the molecules increases and thus the molecules start moving farther and convert to liquid state. The process is called melting.

You might be interested in
One effect of the pesticide ddt upon birds is to inhibit the production of the enzyme carbonic anhydrase, which controls calcium
pav-90 [236]

<u>Answer</u>:

The null hypothesis: the mean egg thickness is 0.2 mm H_{0} =0.2

The alternative hypothesis: the mean egg thickness is less than 0.2 mm H_{1}

In statistics, the null hypothesis states that there is no significant difference between the observed value and the mean thickness. The alternative hypothesis states is the opposite and states the scientist's "idea" behind the experiment. Here, it refers to the fact that due to DDT, the egg shell will be thinner compared to the mean value.

7 0
2 years ago
1. A man yells and rants at a waiter when they accidentally brought him the wrong plate of food.
KATRIN_1 [288]

Behaviorism  

Hope this helps

7 0
3 years ago
Who was A.F.A king ? ​
MariettaO [177]

Answer:

Albert Freeman Africanus King (18 January 1841 – 13 December 1914) was an English-born American physician who witnessed the assassination of Abraham Lincoln on 14 April 1865. He was a bystander physician who was pressed into service during the assassination.

5 0
2 years ago
telophase of mitosis; interphase; phases of mitosis; anaphase of mitosis; what happens in anaphase; prophase mitosis; what happe
Kitty [74]

The chromosomes are separated by a structure called the mitotic spindle.

A chromosome is a lengthy DNA molecule with component or all of the genetic material of an organism. In maximum chromosomes the very lengthy skinny DNA fibers are lined with packaging proteins; in eukaryotic cells the maximum vital of those proteins are the histones. These proteins, aided by chaperone proteins, bind to and condense the DNA molecule to keep its integrity. These chromosomes show a complicated third-dimensional structure, which performs a large position in transcriptional regulation.

Chromosomes are generally seen below a mild microscope best for the duration of the metaphase of molecular division.

To know about chromosomes click here

brainly.com/question/11912112

#SPJ4

3 0
1 year ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Hemophiliacs have blood that does not coagulate well, and they often die at a young age. The disease allele is recessive and X-l
    5·1 answer
  • The ecological relationship between largemouth bass and whirligig beetles is best described as:
    7·1 answer
  • Something that consists of a star and all of the bodies in orbit around it is called ?
    6·2 answers
  • Does bacteria contain genetic information
    12·1 answer
  • What is stem cell?
    6·2 answers
  • Question 5 of 9
    7·2 answers
  • This model of the cell cycle includes two arrows that each represent a process in the cycle. What do the two arrows represent?
    13·1 answer
  • (1 point)
    11·1 answer
  • If your biology project was to make a 3-D cell, which would be easier as a cake? A plant cell or an animal cell?
    14·1 answer
  • NEED ANSWERS ASAP!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!