1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
7

What function do nucleic tides serve besides storing genetic information

Biology
1 answer:
Art [367]3 years ago
7 0
<span>ribonucleic acid (RNA)</span>
You might be interested in
Helpppppppp pleaseeeeeeeeee
Zielflug [23.3K]
1. D. Quercas Alba
2. D. Phyluym
3. A. A<span>rchaebacteria
4. C. Structural Comparisons
5. D. Taxonomy - Classification
6. </span><span>Domain, Kingdom, Phylum, Class, Order, Family, Genus, Species.
7. (If I am reading this question correctly, these are the three characteristics.)   C</span>ell<span> type, Nutrient Acquisition, and Reproduction.</span>
4 0
3 years ago
Characteristics that are always present in living organisms are
andrey2020 [161]
<em>characteristics that are always present in well-developed living organisms are 
</em><u><em>1 digestion
</em></u><em><u>2 excretion
</u><u>3 growth
</u>
<u>4 respiration
5 reproduction
6 circulation of nutrients and food
senses are also present...
</u>
</em>
8 0
3 years ago
Explain the difference between plasma and the formed elements of the blood.
Pavel [41]

Answer:

Blood plasma:

55% composition of blood contains blood plasma. The plasma contains various proteins and coagulating factors. This mainly include the fluid portion of the blood. Plasma is a straw colored liquid that contains antibodies as well as serum.

Formed elements:

45% composition of blood contains formed element. The formed elements contain RBCs, WBCs and platelets. This mainly include the cells portion of the blood. Formed elements is red color or no color depending on the pigment present in the cells of formed element.

3 0
3 years ago
the unicellular spores of the fern ceretopteris richardii are about 100 um in diameter.calculate the surface-area-to-volume rati
WINSTONCH [101]
The surface area will be:
S.A. = 6l²
S.A = 6(100 x 10⁻⁶)²

Volume = l³
Volume = (100 x 10⁻⁶)³

Surface area to volume ratio:
[6(100 x 10⁻⁶)²] / (100 x 10⁻⁶)³
S.A : Vol = 6 x 10⁴
4 0
3 years ago
Which example could be evidence for an organism's growth being influenced by the organism's genes?
QveST [7]

Answer:

C

Explanation:

a hamster species can be made similar by mating together only small hamsters.if uh need explanation let me know.

5 0
3 years ago
Other questions:
  • A ____ is a whole number that has exactly two whole-number factors:1 and itself
    13·2 answers
  • John and Pat are identical twins with identical DNA. John works in a movie theater, and Pat works as a lifeguard. They have very
    9·2 answers
  • Meristem cells _____ into xylem, phloem, and other specialized tissues.
    7·2 answers
  • White fruit color in summer squash is governed by a dominant gene (W) and colored fruit by its recessive allele (w). Yellow frui
    11·1 answer
  • What role do muscles play in an asthma attack?
    11·1 answer
  • I PROMISE TO GIVE BRAINLIEST!!!!! PLEASE HELP MY EXAM IS TIMED!!!! have a great day (:
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Transcribe and then translate the following DNA strand:
    14·1 answer
  • Explain what happens to heat during the Greenhouse effect. Why does this happen?
    13·1 answer
  • What is the Scientific name of the sting ray?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!