1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetradugi [14.3K]
4 years ago
10

Which of these is NOT something that happens when the soil is overused?

Biology
1 answer:
Margarita [4]4 years ago
6 0

Answer:

Doesn't get rotten

Explanation:

I'm smart

You might be interested in
In your own words, give a brief overview of the process of photosynthesis. Include where each phase place within a plant cell.
vodka [1.7K]

Answer:

Photosynthesis has two parts: the light-dependent reactions and the dark reactions (the Calvin cycle). Photosynthesis in a general sense, uses CO2 and water to create C6H12O6 (glucose) and oxygen. The light-dependent reactions use water to make oxygen, and a reduced energy carrier (NADPH) is also created. The Calvin cycle uses carbon dioxide and ATP to create G3P for glucose.

The light-dependent reactions occur on the membrane of the thylakoid and also involve shuttling electrons across different complexes (photosystem II and photosystem I), eventually causing ATP to be created with a proton gradient.

The light-independent reactions/Calvin cycle occur in the stroma of the chloroplast and also involve shuffling carbons around. Carbon dioxide is processed in three stages, and glucose is made from 6 CO2.

7 0
3 years ago
What are the Korean alphabets​
Ivanshal [37]

Answer:

I started reading korean a few days ago

Explanation:

hope it helps

7 0
3 years ago
Read 2 more answers
Can somebody PLEASE help me with this. It is due very soon D:
jonny [76]
In primary succession, newly exposed or newly formed rock is colonized by living things for the first time. In secondary succession, an area that was previously occupied by living things is disturbed, then re-colonized following the disturbance.


Hope this help
7 0
3 years ago
Please help I’ll mark you as brainliest if correct!
Alborosie

Answer:

C It belongs to the domain Eukarya

7 0
3 years ago
Sugar changes into energy in<br> a. golgi bodies<br> b. mitochondria<br> c. nucleus<br> d. nucleolus
hram777 [196]

Answer:

Mithochondria.

Explanation:

You may have heard the phrase "mithochondria is the powerhouse of the cell". This is because, embedded in the inner mithochondrial membrane, there is a protein that is capable of creating ATP by using the energy that results from dissipating the chemoelectric potencial between the intermembrane space and the mithochondrial matrix, by bombing protons (that came from the degradation of sugar) to the mithochondrial matrix.

5 0
3 years ago
Other questions:
  • Do you think that bacterial uptake of a plasmid from the environment is a common event? why or why not?
    12·1 answer
  • Organisms in this kingdom are multi-celled, cannot move, and get their energy by decomposing dead matter.
    15·1 answer
  • Juan inflates a balloon and then releases its end to let the balloon go free as air comes out. The balloon then flies around the
    15·2 answers
  • In a Hardy-Weinberg population with two alleles that show complete dominance, the frequency of the recessive allele is 0.4. What
    12·1 answer
  • You just received a freshwater aquarium as a gift and decide to add more fish. when you get to the pet store, you find that the
    15·2 answers
  • Choose the best explanation of the difference between evolution and natural selection.
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • When compared to Eurkaryotic cells , prokaryotic cells are almost always
    7·1 answer
  • A __________________ _______________________ does not change the substance into anything new.
    6·1 answer
  • In which other way do the skeletal and nervous system interact?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!