1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
14

Which cell carries oxygen though out the body?

Biology
1 answer:
MAVERICK [17]3 years ago
5 0

Answer:

Blood cells are the cells that carry oxygen

blood cells dont only carry Oxygen, blood cells also carry water, minerals, nutrients, and proteins throughout the different parts of the human body

Explanation:

hope this helps :)

You might be interested in
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
With your group members discuss and answer the following questions.
Yakvenalex [24]

1) One seismogram represents the distance to the epicenter (indicated by one circle). This is determined by the arrival times of the P and S waves. When the seismograph is near to a quake, the S-waves arrive shortly after the P-waves.

2) A single or double recording station could only measure distance, not direction; a full circle is drawn around the station to allow for all possibilities.

3) Triangulation is a technique used by scientists to determine the location of an earthquake's epicenter. When seismic data is collected from at least three different locations, the epicenter may be established by where the data links. A network of seismographs positioned in various directions records every earthquake.

4) A seismograph is a device used to record seismic waves caused by an earthquake, explosion, or another Earth-shaking event.

5) In the aftermath of an earthquake, the P waves go ahead of the S waves. As a result, the longer the time difference between the arrival of the P and S waves, the greater the distance between a seismic recording station and the earthquake epicenter.

6) Surface waves frequently induce more ground motion than body waves and hence cause more harm.

<h3>What exactly is a seismograph?</h3>

Seismometers are measuring instruments that detect ground noises and vibrations caused by earthquakes, volcanic eruptions, and explosions. Seismographs usually consist of a seismograph, a timing device, and a recording device.

Modern seismometers are capable of detecting ground movements as small as a few nanometres - a millionth of a millimeter. The magnitude of the earthquake is calculated using the measured amplitudes and its closeness to the hypocenter.

Learn more about seismographs:

brainly.com/question/2679745

#SPJ1

7 0
2 years ago
"Tryptophan self-controls its synthesis." Justify this statement.
miskamm [114]
Just say we have a big amount of tryptophan in the sense that it exceeds, tryptophan would act as a co-repressor which prevents synthesis of more enzymes for its production

Hope this helps :)
6 0
3 years ago
Cells are to tissues as organs are to
Scrat [10]
Organ systems is the answer

4 0
4 years ago
Read 2 more answers
If molecules are small enough then
kakasveta [241]

sorry what this means¯\_(ツ)_/¯

6 0
3 years ago
Other questions:
  • Red and green beetles from a forest migrate to grasslands.In the new environment,green beetles are able to protect themselves be
    5·2 answers
  • Please help me on this one thank you
    5·1 answer
  • which of these is an example of an environment changing slowly? a) flooding b) hurricane c) forest succession d) volcanic erupti
    15·1 answer
  • A lentil with spotted seeds crossed with another that had dotted seeds. The F1 plants turned out to have seeds that had spots an
    9·1 answer
  • The space between the dendrites of one nerve cell and the axon of the?
    8·1 answer
  • Chiasma form during meiosis I but not during mitosis. <br> a. True <br> b. False
    11·1 answer
  • Please help me it would mean the world
    6·1 answer
  • Which of the following is a subsurface event that takes place during the rock cycle? (4 points)
    5·1 answer
  • Looking for good study guide will give brainliest
    15·2 answers
  • The enzyme produced in the kidneys that may play a role in essential hypertension by promoting vasoconstriction is called ______
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!