1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kipiarov [429]
3 years ago
11

Fats or lipids form animal body fat that is used for stored energy and insulation

Biology
1 answer:
saw5 [17]3 years ago
8 0
Fats are a type of lipid, but the most specific answer is fats. Lipids include fats, waxes, oils
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Tissue are ______organs. A)Smaller than. B)Larger than. ​
rewona [7]

Answer:

smaller

Explanation:

organs which are made up of tissues, and are therefore larger than tissues. ... They are therefore larger than organisms.

5 0
3 years ago
if we looked at weather balloon data taken at 12:00 noon instead of 12:00 midnight, what do you think we would see in that data?
Gemiola [76]
“Remember, we are ultimately trying to explain how hailstorms form. We now know the air is colder higher up in the atmosphere than it is near the ground, which helps us understand where it might be cold enough for hailstones to form.
Our next step is to figure out why the air up high is colder. Based on what we have figured out from the weather balloon data, if we gathered more data by moving closer to the ground, what do you think we would see in that data?
In addition, if we looked at weather balloon data taken at 12:00 noon instead of 12:00 midnight, what do you think we would see in that data?
Do you think we would see the same patterns? Why or why not?” Hope this helps if not write in the comments maybe I will be able to find other answers that might help you. If helped mark me the brainiest!! THESE ARE QUOTES DO NOT COPY ITS IS PLAGIARISM!!
7 0
3 years ago
In mice, the gene for tail length has two alleles. A long tail is dominant to a short tail. If a long-tailed mouse that is heter
Anika [276]

Answer: 50%

Explanation: just answered this question

7 0
3 years ago
About one in every 33 babies is born with a birth defect. Not all birth defects can be prevented, but a woman can take steps to
Pani-rosa [81]

Answer:

C

Explanation:

4 0
3 years ago
Other questions:
  • Why is photosynthesis important to both producers and consumers?
    14·1 answer
  • What is the best explanation for why cells are considered the smallest units of living things
    10·1 answer
  • A pathologist who wants to examine a patient's liver cells to determine if the mitochondria have an internal structural defect w
    7·1 answer
  • Some species of ant "farm" aphids by protecting them from predators. in return, the ants feed on a sugar-rich liquid (called hon
    14·1 answer
  • Which organism is the peacock most closely related to?
    12·2 answers
  • What is the function of cellulose in plants
    14·2 answers
  • 21. What does “opt out” mean with regards to Europe’s organ donation policy?
    7·2 answers
  • Bare rock
    12·1 answer
  • Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the
    13·2 answers
  • 4. Why isn't all the energy transferred by sunlight available to plants?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!