1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KATRIN_1 [288]
3 years ago
11

Assuming that a person going to community college can't afford to go to a four-year college is an example of a) a generalization

. b) discrimination. O c) a stereotype. O d) tolerance.
Biology
1 answer:
Elan Coil [88]3 years ago
5 0

Answer: stereotype

Explanation: i am not sure, but my intutions says that.

You might be interested in
All of the following techniques involve hybridization between single-stranded nucleic acid molecules except:
Savatey [412]

Answer:

RFLP analysis.

Explanation:

RFLP (Restriction fragment length polymorphism ) may be defined as a molecular technique used to determine the location of a particular gene in the DNA sequences. The individuals among the population can be easily identified by RFLP analysis.

The restriction enzyme is used for the digestion of DNA sample. The restriction fragments are then visualized by running the fragments on gel electrophoresis. The hybridization between single stranded nucleic acid is not involved in the RFLP.

Thus, the correct answer is option (1).

8 0
3 years ago
Which of the following is not required for osmosis to occur?
Damm [24]

Answer:

Cellular energy

Explanation:

Osmosis is the movement of water from a less concentrated to more concentrated solution across a semi-permeable membrane. Cellular energy is not required in osmosis because it is a passive process. Osmosis is technically more or less the selective diffusion of water molecules across a membrane  that selectively locks out other larger molecule like ions. Water will, therefore, move from the solution where there are more water molecules to the solution with fewer water molecules.

8 0
3 years ago
Are identical twins mutations?<br><br> ASAP
Alex Ar [27]

Answer:

Explanation:

Research published on January 7 in the journal Nature Genetics shows that identical twins differ by an average of 5.2 genetic mutations. The authors argue that these small differences between twins' genetic code could change how scientists study human development.

8 0
3 years ago
Why is it important to prevent gorillas from becoming extinct?
krek1111 [17]
Gorillas are a predator. They eat food and rarely ever get killed for food. But if we take away their habitat by making buildings and houses then they will die for other causes like hunger. If the gorillas go extinct then the food change will get all messed up. The food they normally eat will over populate meaning the food gorillas eat (like fruit) will over populates and take over the area. That means it will start to take up the space that other plants need to grow. The other plants that other animals will need to eat will slowly start moving away because their food is dying. They will start to go somewhere else and mess up that habitat too. Those animals will eat the food needed by the animals that lived there originally and food will become scarce for animals that all need the same type of resources.
3 0
3 years ago
What substance will heat up fastest water, dry sand, wet sand or rock?<br>​
JulsSmile [24]

Answer:

Sand heats up fastest.

4 0
3 years ago
Read 2 more answers
Other questions:
  • oxygen is needed to produce energy in eukaryotic cells. which organelle would you think needs oxygen the most?
    10·2 answers
  • Which of these is one of the steps of the hypothetico-deductive method? mistrusting competing theories refute objections to the
    8·1 answer
  • What is a cell? Why are cells important for living things?<br> Plz
    7·1 answer
  • Which statements describe how maps represent Earth's surface?
    15·1 answer
  • Many countries use DDT to control the spread of deadly __________.
    11·2 answers
  • When an organism becomes infected with bacteria the immune system kicks in to help rid the body of the foreign organisms. Explai
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • should a business owner be more interested in making money or doing what they are passionate about?why?​
    13·1 answer
  • A greyhound dog can run 40 mi/hr is this speed, velocity, or acceleration
    9·2 answers
  • HELPPPPPP QUICKKKKKK!!!!!!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!