1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
11

Which of the following is NOT an unresolved question about the origins of early life? a. Whether the early atmosphere was methan

e rich b. Whether early cells formed in hot or cold environments c. Whether early cells had a membrane surrounding them d. Whether the first life was extraterrestrial
Biology
1 answer:
GaryK [48]3 years ago
6 0

The answer here is D, and it's kind of obvious. But you probably already knew the answer and are just doing this for piece of mind.

Explanation: Just the fact that we don't know whether or not there even is extraterrestrial life rules out every other answer, without even needing to go in depth.

(Okay, I read your question completely wrong, it's asking for which one of these has been solved isn't it?)

This is tough because all of these other than D have been figured out. Go with the methane atmosphere then.

You might be interested in
What happens if the correct ligand binds to ligand-gated sodium channel in a post-synaptic neuron?
Maru [420]

Answer:

Post-synaptic neurons after receiving correct ligands called as neurotransmitter in correct amount generates action potential. This action potential may be inhibitory or accelatory.

Explanation:

Postsynaptic neuron :

These are the neurons that is present after the gap called synapse. These neurons after receiving correct ligands called as neurotransmitter in correct amount generates action potential. This action potential may be inhibitory or accelatory.

There are number of neurotransmitter. These includes

GABA ergic: This neurotransmitter is often inhibitory.

glutamatergic: This neurotransmitter is often excitatory.

Adrenergic: This neurotransmitter releases norepinephrine.

Cholinergic: This neurotransmitter activates vertebrate neuromuscular junction.

6 0
3 years ago
Why does the human body maintain a constant pH of its blood
IRISSAK [1]
Because if there is a minimal variation of it the normal state of pH, it can cause severe effects in the brain, arteries, the heart, and other organs. 
In other words, it can have some serious effects on the body systems that can lead big diseases, like cancer. 
6 0
3 years ago
When human dna is inserted into a bacterial plasmid the resulting bacterium will then?
Serhud [2]
Will then be placed into a vaccine and used to fight off viruses that attack humans.
4 0
3 years ago
un caballo negro de antepasados desconocidos fue apareado con cierto numero de yeguas de color rojo deraza pura, estos apareamie
konstantin123 [22]

Pregunta completa: un caballo negro de antepasados desconocidos fue apareado con cierto numero de yeguas de color rojo de raza pura, estos apareamientos dieron 20 descendientes de colo rojo y 25 de color negros.

A) cual de dichos caracteres fenotipicos es mas probable que este causado por un homocigoto recesivo?

B) segun su hipotesis cuantos individuos de cada clase habrian esperado

Answer:

A) El color rojo es causado por un genotipo homocigota recesivo

B) Se habrían esperado 22.5 individuos negros y 22.5 individuos rojos, que juntos sumarian un total de 45 individuos.

Explanation:

El desarrollo del problema se encuentra disponible en el archivo adjunto

Download pdf
3 0
3 years ago
INTRODUCT
DIA [1.3K]

Answer: C. Histologist

Explanation:

A cell biologist refers to a person who studies cells and their functions and their interactions with the biological organisms.

A taxonomist refers to a biologist who classifies organisms into their categories.

A histologist, can also be called a histotechnician, and this is someone who prepares tissue samples for the pathologist to study. A histologist cut samples from organs which are used for microscopic tissue analysis.

Palaeontologist is a person who studies fossils in order to get information regarding life on Earth.

8 0
3 years ago
Other questions:
  • Which protein inhibits interaction between actin and myosin to prevent skeletal muscle contraction; and which ions remove the in
    8·1 answer
  • When a dead plant dies the matter that made up its body goes into the soil which of the following might next happen to the dead
    5·1 answer
  • 1.
    15·1 answer
  • Which activity distinguishes the larva stage from the pupa stage of an insect?
    5·1 answer
  • Recall the discussion of mythical places in unit eight. would firefly forest be considered a mythical place? why or why not?
    11·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • 14. Which of the following may produce more than one functional protein
    12·1 answer
  • Mention 3 uses of the diaphragm in the body​
    8·2 answers
  • Which set parings correctly matches matches the process with its conditions
    6·1 answer
  • Over a long period of time incomplete observations can be combined to form a complete explanation.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!