1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olya-2409 [2.1K]
3 years ago
15

The correct order of blood flow through the body starting with blood in the Right Atrium

Biology
2 answers:
Amanda [17]3 years ago
7 0

Answer:

69

Explanation:

Lina20 [59]3 years ago
7 0

Answer:

1. Deoxygenated blood enters through the inferior or superior vena cava

2. This deoxygenated blood enters the Right Atrium

3. The Tricuspid Valve opens and the deoxygenated bloods moves through to the next chamber

4. The deoxygenated blood flows into the right ventricle

5. The blood then goes through the pulmonary artery to the lungs

6. In the lungs the carbon dioxide is dropped off and the oxygen is picked up

7. The oxygenated blood returns to the heart through the pulmonary veins

8. The blood empties into the left atrium

9. The bicuspid valve opens and blood flows through the left ventricle

10. The oxygenated blood enters the aorta where it is then pushed to the rest of the body’s cell

Explanation:

You might be interested in
The largest amount of DNA in a plant cell is found in?
irina1246 [14]
Mitochondria is where the largest amount of dna is stored
7 0
4 years ago
In an aquatic ecosystem, the aquatic plants are eaten by small invertebrates that in turn are eaten by crayfish, which are eaten
makvit [3.9K]

Answer:

Aquatic plants

Explanation:

Aquatic biomass is energy crops which do not remain competitive for territory or any other energy with food plants. Aquatic biomass consists of various micro, macro- and aquatic plant species. The highest priority has been given to HTL treating aquatic biomass because microalgae are suitable for use and can potentially deliver the highest levels of biomass per area. Aquatic biomass, such as seaweed, algae and aquatic plants, is likely to achieve part of the growing biomass want.

7 0
3 years ago
Since 1735, the Linnaean classification system has been the basic system for all taxonomy in biology. Which statement best expla
jeka94

Answer:

New information about the genetics of species is being discovered.

8 0
2 years ago
Electric current is the flow of ________ through a substance.
antoniya [11.8K]

Answer:

Electrons

Explanation:

3 0
3 years ago
Read 2 more answers
Bagaimanakah biodiversiti dapat menjana ekonomi?​
ASHA 777 [7]

Answer:

nova doez tueans dto tiesday no uanod

7 0
3 years ago
Other questions:
  • What role do nerve cells play in the human body? They allow the body to react to stimuli. They regulate the exchange of chemical
    13·2 answers
  • In a species of insect, wing length is determined by a single gene, for which there are only two alleles. in a population of 150
    5·2 answers
  • Circulatory system of man is made up of which muscle <br> a)Smooth <br> b)Cardiac <br> c)Skeletal
    13·2 answers
  • What chemical weathering agent does acid rain contain
    5·2 answers
  • You can be infected with a virus and not even know it.<br> a. True<br> b. False
    11·2 answers
  • PLS PLS HELP ITS BIOLOGYYYYY
    12·2 answers
  • A. Which form of nitrogen in the soil is NOT usable by organisms?
    7·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • The energy in living things on Earth
    15·1 answer
  • Mitosis can occur in both haploid and diploid cells, but meiosis cannot occur in haploid cells. Why not?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!