1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
almond37 [142]
2 years ago
9

1. All ____________ organisms are composed of ______ or _______ cells.

Biology
2 answers:
Diano4ka-milaya [45]2 years ago
8 0
Living one, or more.
Elan Coil [88]2 years ago
7 0
All living organisms are composed of one or more cells.
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Which kingdom has 2 kingdoms that are all unicellular?
dalvyx [7]

Answer: Prokaryotes, archaea, protists, fungi, algae.

Explanation:I don’t think there are any single celled organisms that are today classified as animals. So basically I just left the animal kingdom out. Both metazoans and sponges are for the most part multicellular.

5 0
3 years ago
Read 2 more answers
Overflow flooding occurs in different areas that are called_____.
andreev551 [17]

flood prone areas

is the name

7 0
2 years ago
What is a macromolecule? Identify the four types of biological macromolecules
insens350 [35]
A macromolecule is a large molecule containing many atoms. The four type are carbohydrates, lipids, proteins, and nucleus acids.
8 0
3 years ago
What is the term for each step in the transfer of energy and matter within a food web?
Artist 52 [7]
The term is known as TROPHIC LEVEL...........
7 0
3 years ago
Other questions:
  • Where the best place to find information about the hazards that are associated with a compound
    15·2 answers
  • Wha does it mean to selective breed an organism
    10·2 answers
  • List three solutions that scientists are suggesting to solve the problems caused by monoculture farming
    12·2 answers
  • If plants disappeared how long would oxygen last
    13·1 answer
  • Why is it important to evaluate the stigma in a flower?
    14·1 answer
  • Why is freezing water extremely biologically relevant?
    6·1 answer
  • Which scenario describes an interaction between two of Earth's spheres?
    9·1 answer
  • What does the D in DNA stand for?
    15·2 answers
  • In general, how do many human activities influence the carbon cycle?
    11·1 answer
  • Jajajajajajanjhashdb,jhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!