1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jolli1 [7]
3 years ago
6

The main purpose of mitosis is _____.

Biology
1 answer:
stellarik [79]3 years ago
4 0

Answer:

allowing for repair ,replacement and growth

You might be interested in
Which of the following is true regarding the global distribution of biodiversity?
katen-ka-za [31]
Do you have a link or picture?
7 0
4 years ago
Read 2 more answers
The Celsius temperature scale is also something called the centigrade scale. Why is this?
valentinak56 [21]
There are three temperature scales in use today, Fahrenheit, Celsius and Kelvin.

Fahrenheit temperature scale is a scale based on 32 for the freezing point of water and 212 for the boiling point of water, the interval between the two being divided into 180 parts. The 18th-century German physicist Daniel Gabriel Fahrenheit originally took as the zero of his scale the temperature of an equal ice-salt mixture and selected the values of 30 and 90 for the freezing point of water and normal body temperature, respectively; these later were revised to 32 and 96, but the final scale required an adjustment to 98.6 for the latter value.

Until the 1970s the Fahrenheit temperature scale was in general common use in English-speaking countries; the Celsius, or centigrade, scale was employed in most other countries and for scientific purposes worldwide. Since that time, however, most English-speaking countries have officially adopted the Celsius scale. The conversion formula for a temperature that is expressed on the Celsius (C) scale to its Fahrenheit (F) representation is: F = 9/5C + 32.


Hope this helps.

4 0
3 years ago
The small in holes found on the plant leaves are called ​
BabaBlast [244]

There are called the stomata

6 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Chronic jet lag produces ________ that may be permanent.
Fofino [41]
Chronic jetlag can cause cognitive deficits that can be permanent. This happens because the normal circadian rhythm of the body is disrupted. The endogenous system of circadian timing in the body adapts slowly. This disturbance  can impair the physical and psychological health of the person.
7 0
3 years ago
Other questions:
  • Can someone please help me with questions 1,2 and 3 please:)
    9·1 answer
  • A plant shows incomplete dominance in flower color. Red flowers are homozygous dominant, white flowers are homozygous recessive,
    9·1 answer
  • A dependent variable has to be what
    14·1 answer
  • Responding to the environment by maintaining a stable internal environment despite changing external conditions is
    12·2 answers
  • Describe the structure of atoms,including the masses, electrical charges, and locations of protons, neutrons and electrons.
    10·1 answer
  • A DNA strand has 30% guanine. How much adenine would there be in the same strand
    15·1 answer
  • Which of the following best describes why someone with an immunodeficiency disorders may get sick more easily than someone witho
    10·2 answers
  • Pls help me answer this question I'm really tired!!
    6·2 answers
  • Which of the following is not a benefit of Photosynthesis? A. Organic molecules for growth are created. B. Energy for cellular p
    9·1 answer
  • When glucose is made, which of the following can happen to it
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!