1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
13

TIME REMAINING

Biology
1 answer:
jolli1 [7]3 years ago
3 0

Answer:

a

a process that selects variations to help with survi al and that spreads the variation to more offspring

Explanation:

the weak don't survive the strong thrive

You might be interested in
Construction contributes to soil erosion because...
Mamont248 [21]

Construction contributes to soil erosion because;

C. It removes vegetation from the building site.

8 0
3 years ago
Read 2 more answers
Select all that apply. Factors that can increase mutation rates are _____. high temperatureslow temperaturesfood additivesUV ray
Artemon [7]
<span>Factors that can increase mutation rates are high and low temperatures, food additives, and UV rays. All of these answers are correct. Mutation rates in genes vary depending on many environmental effects. UV rays, along with varying temperatures, can cause mutations during cell division due to the damage they impart on the cells that are dividing. Dangerous food additives are believed to cause mutations, as seen in animal studies (ie. aspartame causing cancer in rats).</span>
4 0
3 years ago
Read 2 more answers
___________ is the total of all of the chemical reactions that occur in organisms
antiseptic1488 [7]
It would be metabolism 
4 0
3 years ago
What conclusions can you make about how a change in the condition of the ocean affects the different species in coral reefs?
Kaylis [27]

When the ocean´s conditions change over a period of time everything in it also changes, they have to adapt to the changes.

5 0
3 years ago
Newton's second law can be demonstrated by which of the following
shutvik [7]

Newton's second law can be demonstrated by something very massive (high mass) that’s changing speed very slowly (low acceleration) and something very small (low mass) that’s changing speed very quickly (high acceleration. Thus, both the options A and B are correct.

<h3>What is Newton's second law?</h3>

According to newton second law of motion force is always equal to rate change of momentum.

So, Force basically depend on two factor i.e mass and velocity

In first case if mass is constant and velocity is variable then

Force = mass × acceleration.

And if mass is variable and velocity is constant then it's called thrust force

Thrust force = Rate change of mass × velocity.

S.I unit of mass is Newton.

Therefore, Newton's second law can be demonstrated by something very massive (high mass) that’s changing speed very slowly (low acceleration) and something very small (low mass) that’s changing speed very quickly (high acceleration. Thus, both the options A and B are correct.

Learn more about Newton's second law here:

brainly.com/question/13447525

#SPJ1

8 0
1 year ago
Other questions:
  • Chantal was eating raisins and a few of them fell into her glass of drinking water. She finished eating the rest of the raisins.
    11·2 answers
  • How are organelles in a prokaryotic cell different from those in a eukaryotic cell
    13·1 answer
  • Louisa put a bowl of water and a bowl of sand in the sun. She put a thermometer in each bowl. Then she recorded the temperature
    11·2 answers
  • A student sets up an experiment according to the date table below.Based on the table,which question was the student most likely
    12·1 answer
  • 8) Amylase becomes denatured at a temperature of 80°C. During an experiment to study the effect of varying temperature on enzyme
    11·1 answer
  • Some argue that wind power should be used more than it is now. What
    13·1 answer
  • To keep non-recyclable aluminum scraps leftover from manufacturing processes out of a landfill, what new product was discussed i
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Significance of soil air​
    6·1 answer
  • Complete a online search and write at least two sentences to explain the relationship between the two organisms (Humans and the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!