1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet [91]
2 years ago
7

What is the mRNA sequence for the template strand DNA sequence?3' TACAAACTAGAA 5' *

Biology
1 answer:
True [87]2 years ago
8 0

Answer:

5' AUGUUUGAUCUU 3'

Explanation:

The nucleotide bases for mRNA are Adenine, Guanine, Cytosine, and Uracil. Uracil replaces Thymine (it's DNA counterpart). From this, you can eliminate options C and D.

Then it is just matching pairs: Adenine = Uracil , Cytosine = Guanine.

3' TACAAACTAGAA 5'

5' AUGUUUGAUCUU 3'

You might be interested in
4. Why is it important for a scientist to think about their sample size if they are going to extrapolate their data?
Annette [7]
I don’t know but pointers
7 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Which of the following is the goal of the peer review process?
Masja [62]

Answer:  The ultimate goal of the peer review process is that you can have others review and look over your work for things that are incorrect, need fixing, or need rewording.  When we write things on our own, we sometimes make unconscious errors that we sometimes do not even catch in revision.  Having a new set of eyes look at something helps to catch errors that we might miss.  It is very similar to reading your work out load to catch errors, as reading something out loud is another effective strategy when reviewing your work.

7 0
3 years ago
Circle or highlight the six most common elements found in living things. do the same thing for the five other elements that are
Marrrta [24]
What are the elements
3 0
3 years ago
Read 2 more answers
Which statement is most accurate about viruses? A They can reproduce. B They are autotrophs. C They contain organelles. D They a
Gwar [14]
<span>E. chemical complexes of RNA or DNA protected by protein shell

https://quizlet.com/9713220/chapter-20-viruses-bacteria-and-archaea-flash-cards/

</span>
4 0
3 years ago
Other questions:
  • Which immune system cells act as hungry scavengers that trap and ingest worn-out cells?
    6·1 answer
  • Jayden has been given 5 cubic centimeters each of 4 unknown samples of gaseous substance. He has been asked to identity which on
    14·1 answer
  • Photosynthesis is a process in which plants prepare food using carbon dioxide, chlorophyll, and water in the presence of sunligh
    8·2 answers
  • ________ are permanent alterations in a cell's dna that affect the nucleotide sequence of one or more genes.
    13·1 answer
  • Which is NOT true of lipids?
    11·2 answers
  • Which type of fossils is MOST helpfu
    8·1 answer
  • Strength between particles is called​
    14·1 answer
  • What macromolecules and biomolecules are critical for<br> cellular respiration to occur?
    9·1 answer
  • How can the process melting and cooling of magma affect the rock cycle
    6·1 answer
  • This is a molecule of glucose, a simple carbohydrate. If this molecule were broken down, would it provide all of the elements ne
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!