1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
5

The probable reason for the increase of carbon dioxide is _____.

Biology
1 answer:
DaniilM [7]3 years ago
3 0
D, because if you burn fossil fuel the smoke while burning the fossil fuel is carbon dioxide and we live off fossil fuel and that means we use a lot of fossil fuel.
You might be interested in
What are the components of adenosine triphosphate (ATP)?
Liula [17]

Answer:

base, sugar and three phosphates

3 0
2 years ago
Using "i" statements: O A. Always makes your point to the other person OB. Starts arguments OC. Helps eliminate name-calling OD
irinina [24]

Answer:

aa is a good place to start and 3333333333333333 to get out of Daviess and you will pay renttry a lot more than that you and your family and you can afford to be a little more hour than

6 0
3 years ago
Most coastal areas on Earth experience two high tides and two low tides every lunar day. What is a lunar day? Our days on Earth
ahrayia [7]

The correct answer is - C) 5:35 PM Friday.

The low tides occur twice in a lunar day, thus they are diurnal. The low tides appear when the Moon is between that point of the planet and the opposite of that point of the planet, thus in between, which is happening twice, on opposite parts of the planet.

Since the lunar day lasts for 24 h 50 m, we should just divide it in two, thus get 12 h 25 m. Than we should add the 12 h 25 to the time when one of the low tides appeared, which is 5:10 AM, so we will get 5:35 PM.

The low tides appear because the Moon is pulling the water upwards with its gravitational pull above the place where it is, so the side parts of the planet have their waters dragged away,thus resulting in the retreating of the water, known as low tide.

3 0
2 years ago
Read 2 more answers
What is it called when u only eat chicken and fish?
Airida [17]
Its called an <span>pesco pollo vegetarian</span>
5 0
3 years ago
How does global warming lead to succession events?
MissTica

Answer:

Due to increase temperature and drought condition.

Explanation:

Succession refers to the changes occur in the structure of a biological community with the passage of time. Global warming has a great affect on the succession events because the vegetative cover present in that area vanished due to increase in temperature which is unbearable for the vegetation and also drought condition occurs in that area due to no rainfall. Instead of vegetative cover, a new plant specie formed which has the ability to exists in that environment.

6 0
3 years ago
Other questions:
  • Two bird populations live on opposite sides of a mountain range. One particularly harsh winter, the blue birds on the north side
    15·1 answer
  • Which of the following is a consequence of acid deposition? Group of answer choices A) It increases the likelihood of low-lying
    12·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is a volcano that is erupting or has erupted in the last 100 years called?
    15·1 answer
  • Humans can digest starch but not cellulose because _____. the monomer of starch is glucose, while the monomer of cellulose is ga
    9·1 answer
  • The nursing student correctly identifies the class of drugs that exerts their bactericidal effect by interfering with the synthe
    11·1 answer
  • Papaya leaves have veins that resemble fingers diverging from a palm. Papaya leaves are an example of which venation pattern?
    8·2 answers
  • How to avoid dehumanization in the hospital
    14·1 answer
  • What is the function of each of the types of cells that make up the nervous system?
    14·1 answer
  • TRUE OR FALSE Thyroid hormones increase the sensitivity of the cells to growth hormone.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!