1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
12

PHET Energy Skate Park Simulation .Consider this equation: gravitational potential energy = mgh. Which of those variables is cha

nging as the skater moves up and down the track?
Biology
1 answer:
Fed [463]3 years ago
8 0

Answer:

h - height

Explanation:

gravitational potential energy = m * g * h

m stands for mass. Mass doesn't change in physics

g stands for gravitational acceleration. It is a constant.

h stands for height. When the skater moves up and down the track the height from the ground changes. Therefore this variable does change.

You might be interested in
Determine whether the statement is true or false, and why. “If a point mutation occurs in a tumor gene it can become activated.
solmaris [256]

Answer: A. False, it should read “If a point mutation occurs in a tumor suppressor gene it can become inactivated. This allows the rate of cell division to increase unregulated.”

Explanation: I already know this for a fact.

4 0
3 years ago
Refer to Animation: Endomembrane System. Consider a protein that is targeted to be excreted to the outside of the plasma membran
Murljashka [212]

IN THE LUMEN INSIDE OF THE ENDOPLASMIC RECTICULUM.

<u>Explanation:</u>

The endoplasmic recticulum is the continuous membrane system that forms that forms the more number of flattened within the cytoplasm of eukaryotic cells and performs the multiple process in the cell.

The immportant functions of endoplasmic recticulum is folding, synthesis, modification, ans transport of the protein. The lumen is the protein which is present in the endoplasmic recticulum.

The lumen of the endoplasmic recticulum is the area closed by the endoplasmic recticulum membrane, it is an extensive network of the membrane tubues, visicles, and flattened the cisternae found in the eukaryotic cells.

7 0
3 years ago
Pepsin begins the breakdown of _______ into _______.
deff fn [24]
The answer would be B i believe<span>(a protease) begins the chemical digestion of protein</span>
4 0
3 years ago
Which is an abiotic factor of the boomslang's environment?
jonny [76]
A. The sun
Abiotic means fake or not living. Trees, grass, and people are living, also know as biotic. The sun is not living, it’s just a ball of hot gas, which is not living.
8 0
3 years ago
Patches of suitable habitat surrounded by unsuitable habitat is called
Anna71 [15]

Answer:

Habitat fragmentation

Explanation:

Habitat fragmentation occurs when a particular habitat breaks up i.e. becomes discontinuous. That means areas of suitable habitat are surrounded by areas unfavorable for the survival of organisms.

This is common during the destruction of previously large areas of forest.

3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is it called when molecules move from low to high concentration across plasma membranes?
    14·1 answer
  • A species including only organisms that can reproduce
    13·1 answer
  • What was the name of the original supercontinent that Werner proposed in his theory A. Atlantis B. Gondwanaland C. Laurasia D. P
    8·2 answers
  • Which organ systems help deliver oxygen to body cells?
    12·2 answers
  • What do animal cells have that plant cells do not?
    6·1 answer
  • What super hero had a change or mutation occur in their DNA that gave them their super power?
    11·2 answers
  • Structure and Properties of Matter:Question 4
    15·1 answer
  • What property best describe this attraction
    14·1 answer
  • What process adds carbon dioxide to the air?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!