1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Producers NEED the following raw materials to create food for themselves (check all that apply)

Biology
1 answer:
Verizon [17]3 years ago
8 0

Answer: Water, Sunlight, Carbon Dioxide, and oxygen

Explanation: Hope this helps

You might be interested in
How does photosynthesis effect the hydrosphere
Ghella [55]

Explanation:

Plants consume carbon dioxide—a significant greenhouse gas—in the process of photosynthesis. The reduction of carbon dioxide in the atmosphere has an indirect cooling effect.

8 0
4 years ago
Bones are are hell together at the joints by connective tissue called
Zepler [3.9K]
The bones are connected together by <span>Ligaments, which make up a joint, now if it were muscle it would be a tendon.</span>
8 0
4 years ago
the mutation of the brca1 gene normally functions to ensure? a)breast cancer cells duplicate b)suppress tumor function c)the per
DedPeter [7]
I believe the answer is B!
3 0
4 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
4 years ago
Helppppp:
qaws [65]
It is an anion because anions are negatively charged atoms. A proton is positive and an electron is negative. If you have more electrons than protons, you are left with a negative charge.
3 0
3 years ago
Other questions:
  • Studies of fat cells a d thyroid cells show that fat cells have fewer mitochondria than thyroid cells. A biologist would most li
    15·1 answer
  • Flowering plants are also vascular plants. Based on the cladogram, what other members of the kingdom Plantae also have vascular
    6·2 answers
  • According to the theory of evolution ______ traits will become common in a population over time. female favorable male recessive
    8·1 answer
  • Which statements about this diagram are true? Check all that apply. Layers 5 and 7 are the same age. Faulting created the differ
    6·2 answers
  • The two bones of the lower arm are _____.
    10·1 answer
  • Which of the following is not true concerning the Pleistocene ice age.
    9·2 answers
  • Traditionally, girls score higher than boys on tests that measure verbal fluency.
    5·2 answers
  • Which type of rock contains the most fossils, and why?​
    13·1 answer
  • Part 1:
    7·1 answer
  • What is the homeostatic imbalance in staphylococcus infection???
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!