1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
6

Guys helpppppp please and I hope y’all have a great day

Biology
1 answer:
Lynna [10]3 years ago
6 0

Answer:

Ok so

Explanation:

1. DNA

2.A , G , C and T

3.The 3-dimensional double helix structure of DNA, correctly elucidated by James Watson and Francis Crick. Complementary bases are held together as a pair by hydrogen bonds.

4.Chargaff's realization that A = T and C = G, combined with some crucially important X-ray crystallography work by English researchers Rosalind Franklin and Maurice Wilkins, contributed to Watson and Crick's derivation of the three-dimensional, double-helical model for the structure of DNA.

5.Created by Rosalind Franklin using a technique called X-ray crystallography, it revealed the helical shape of the DNA molecule. Watson and Crick realized that DNA was made up of two chains of nucleotide pairs that encode the genetic information for all living things.

6. 1869

7.The double helix of DNA is, like its name implies, in the shape of a helix which is essentially a three dimensional spiral. The double comes from the fact that the helix is made of two long strands of DNA that are intertwined—sort of like a twisted ladder.

8. In DNA, the code letters are A, T, G, and C, which stand for the chemicals adenine, thymine, guanine, and cytosine, respectively. In base pairing, adenine always pairs with thymine, and guanine always pairs with cytosine.

9. A gene is the basic physical and functional unit of heredity. Genes are made up of DNA. Some genes act as instructions to make molecules called proteins. ... Every person has two copies of each gene, one inherited from each parent.

10. 20

11. A group of disorders that cause red blood cells to become misshapen and break down.

With sickle cell disease, an inherited group of disorders, red blood cells contort into a sickle shape. The cells die early, leaving a shortage of healthy red blood cells (sickle cell anaemia) and can block blood flow causing pain (sickle cell crisis).

12. Sickle cell anemia is caused by a mutation in the gene that tells your body to make the iron-rich compound that makes blood red and enables red blood cells to carry oxygen from your lungs throughout your body (hemoglobin).

13. The Human Genome Project was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional standpoint.

I'm so absolutely sorry if this is long. Good lucj with ur work ;D

You might be interested in
The autonomic nervous system exerts its influence on
Andru [333]
The autonomic nervous system releases chemical messengers to influence its target organs
3 0
3 years ago
What is la Nina <br><br><br><br> (in weather science)<br><br><br> plz help :C
Hitman42 [59]

Answer:

opposite of el nino (do not have accent mark sadly) the waters around the equator are colder than regular and happens in intervals

Explanation:

6 0
3 years ago
Read 2 more answers
An idea that is supported by some evidence, but is not yet the basis for a field
PolarNik [594]

Answer: trite a hypothesis

Explanation:

The basic idea of a hypothesis is that there is no pre-determined outcome. For a hypothesis to be termed a scientific hypothesis, it has to be something that can be supported or refuted through carefully crafted experimentation or observation.

7 0
3 years ago
Question 6 (2 points) Which is an example of artificial selection? a b Big Horn sheep fighting to defend females, who mostly bre
Tomtit [17]

Answer:

the one with the race horse. brainliest?

Explanation:

3 0
3 years ago
Which organisms develop gills from pharyngeal arches and later develop lungs to breathe on land? Frog Scallop Salamander Scorpio
Sladkaya [172]

Answer:

frog

Explanation:

frogs live their first part of their lives in water so they need gills but after metamorphosis they live on land so they need lungs.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following organisms would be members of a pioneer community on bare rock? A. grass B. lichens C. herbs D. moss E. t
    14·1 answer
  • How does therapy help in the treatment of depression
    8·1 answer
  • Personal values and work values cannot be related. ture or false?
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Based on the DNA which populations do you think live in closer proximity to each other. What do you expect to see when comparing
    13·2 answers
  • Which statement about inheritance is true? Girls get most of their traits from their moms; boys get most of their traits from th
    14·2 answers
  • Krypton is named after the Greek word that means “secret.” Which explains why krypton was most likely given this name? Krypton i
    15·2 answers
  • Nora traveled for the first time by air. Just before take-off, she felt nauseated. Now that she has made a few more trips, she d
    10·2 answers
  • Where are solar panel farms built?
    9·2 answers
  • Which of the following is true of gravity?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!