1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
9

A triangle where one angle 120 degrees and another 50 degrees

Mathematics
1 answer:
hram777 [196]3 years ago
7 0

I do not understand what you are asking for

I am assuming you want the missing angle, in this case it is 10

Triangle Sum Theorem states that a triangle is equal to 180 degrees

120+50 = 170

180-170

= 10

You might be interested in
R varies directly as s. Find r when s=4 and k=2
lesya692 [45]
\bf \begin{array}{cccccclllll}
\textit{something}&&\textit{varies directly to}&&\textit{something else}\\ \quad \\
\textit{something}&=&{{ \textit{some value}}}&\cdot &\textit{something else}\\ \quad \\
y&=&{{ k}}&\cdot&x
\\
&&  y={{ k }}x
\end{array}\\\\
-------------------------------\\\\
thus\implies r=ks\qquad 
\begin{cases}
k=2\\
\uparrow \\
constant\ of\\
variation\\
s=4
\end{cases}\implies r=2\cdot 4
5 0
3 years ago
Plot the
Bumek [7]

Answer:

You would want to draw the middle (not shaded part) of the graph.

Red is x-y=0

Blue is x+y=8

7 0
4 years ago
so…I need help with this! It would be very helpful if you also put the steps so I can write them down in my notebook so I can kn
skelet666 [1.2K]
Okay so you plug in 6.7 to M because that’s how far you are.
You are looking for T because it says seconds after.
So 6.7=t/4.6
then you multiply both sides by 4.6.
6.7x4.6=30.82.
So your answer is 30.82
8 0
4 years ago
Read 2 more answers
ted runs two-thirds as fast as frank. in 2hr frank runs 8mi farther than ted. how fast does each run?
charle [14.2K]

Answer:

In 2 hr Frank runs 8 mi farther than Ted

Step-by-step explanation:

7 0
3 years ago
Solve by quadratic formula:<br> 3x^2 - 10x - 20= 0
Arlecino [84]

this is your answer, i hope this helps you

5 0
4 years ago
Other questions:
  • The sum of the interior angles of a polygon is 9900degrees how many sides does the ploygon have?
    7·2 answers
  • What is the volume of this rectangular prism?
    6·1 answer
  • How to do this? And state it cause Idk how
    6·2 answers
  • Which of the following rational functions is graphed below?
    11·1 answer
  • Solve 5x - (2x + 2) = x + (3x + 5) (make sure to type the number only)
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • If x + 12 = 25. What is the value of 8x - 30?
    5·2 answers
  • Can someone help me please, ASAP!! Thank you!
    12·1 answer
  • X + 7 &gt; 10<br> Solution is
    7·2 answers
  • 2.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!