1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Illusion [34]
2 years ago
9

To become an appeals court judge, an individual must have been a practicing attorney. False True

Law
1 answer:
serious [3.7K]2 years ago
5 0

Answer: False

Explanation:

An Appeals Court Judge is a Federal Judge which means they have to be nominated by the President and approved by the Senate. The requirements to be nominated however, are not very stringent.

A nominee for instance, does not even have to hold a law degree talk more of having been a practicing attorney. Although informal criteria exists, they do not revolve around an individual having been a practicing attorney so this statement is false.

You might be interested in
This lesson reviewed how Supreme Court justices, as well as other
grigory [225]

Answer:

No, I do not agree. Judges should not be appointed for life. Sometimes the judges might have terible opinions and may be biased.

Explanation:

3 0
2 years ago
What are the relationships among community policing, problem-oriented policing, and intelligence-led policing? Are they similar
gladu [14]
They are similar because relationship amongst police can either affect some and harm others
3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Mr. Bakhtawar, a Individual Person, has following information for the Tax Year 2020.
mr_godi [17]
Just try to search it
7 0
2 years ago
Federal law prohibits the possession or
GrogVix [38]
I believe the answer is true. because 18+ you are not considered a child.
4 0
3 years ago
Other questions:
  • What was Susan B Anthony vs. The United States of America about?
    9·2 answers
  • A contract between a business and a state recognizing the business as an artificial person is known as the​
    11·1 answer
  • Sally agrees to roof a house for Bob. After doing his research, Bob chooses Sally based on her great reputation for being consci
    13·1 answer
  • What does knowledge do to your own theoretical PPF? Why is it important at any stage of your life, but especially in high school
    12·1 answer
  • If a witness offers an out-of-court statement made by
    11·1 answer
  • Why are constitutionally guaranteed civil rights important to American
    7·2 answers
  • What principles of government are included in the Declaration of Independence, Articles of Confederation, United States Constitu
    11·1 answer
  • Abdel fields vs United States explained
    8·1 answer
  • What is the difference between declaration and statement?
    14·2 answers
  • What is the texas constitutional amendment special election
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!