1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garri49 [273]
3 years ago
6

Certain species of velvet worms have only female individuals and no males. These worms reproduce asexually. What is one advantag

e of asexual reproduction for these worms?
Biology
1 answer:
Nady [450]3 years ago
8 0
Okay bestayyy go off queen ahhh
You might be interested in
2. The graphs below show how two species grew under different conditions.
Naily [24]

Answer:

G

Explanation:

The answer is G

6 0
3 years ago
Water in all three states is still water Question 3 options: True False
Xelga [282]

Answer:

The awnser is false

Explanation:

In liquid form it is water but ounce the other forms start it will eithr turn to solid form ice or gas form vapor

6 0
3 years ago
Proteins are formed from monomers (subunits) called
Gwar [14]
Proteins are formed from monomers called amino acids. These are naturally found substances that polymerize in order to form proteins. These are compounds which has amine and carboxyl groups and are characterized by an R-group. In proteins, there are about 20 amino acids that can be found.
3 0
3 years ago
As you are walking through a forest in Ohio, you notice that there are many large, mature trees. But you also notice patches of
Bad White [126]

Answer:

Transition

Explanation:

Secondary succession occurs when the existing vegetation is removed by some disturbances and soil is already present in the region to support the growth of new species. During succession, the early species are being replaced by later successional species.

In the given example, the forest has patches of early species and later species. This means that the forest is in the transition period of succession where early species were not completely replaced by the new species. Once the early species will be removed and the climax community develops, the forest has reached the final stage of succession.

7 0
3 years ago
identify and describe two technologies that have changed the way humans influence the inheritance of desired traits in plants an
Bas_tet [7]
Microscope allowed us to find known parasites, micro living things.
Technology allowed us to inherit knowledge on different plants and animals
6 0
3 years ago
Other questions:
  • Many crops such as tomatoes and corn are now routinely genetically manipulated to become more resistant to disease and herbicide
    12·2 answers
  • Imagine that you are a graduate student working in a cancer lab. You accidentally mix unlabeled tubes of carcinoma cells with tu
    12·1 answer
  • "which are characteristics of the extrinsic muscles of the larynx"
    7·1 answer
  • What might happen in a community if all the nitrogen-fixing bacteria died?
    8·2 answers
  • In a certain variety of chicken, some offspring have a feather pattern that is black-and-white checkered. Chickens with this che
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • .... Weak attraction
    8·1 answer
  • What is one of the different forms of a gene called? A(n)________ is one of the different forms of a gene.
    10·2 answers
  • Question 10 5 pts Live or Die challenge (multiple answers): you are walking in the woods just with water and a Black Bear lookin
    11·1 answer
  • A researcher used PTC taste paper to estimate the number of non-tasters in a group of customers entering the UD creamery. She fo
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!