1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
9

Compare and contrast photosynthesis and cellular respiration. Many cellular processes rely on an electron donor and/or acceptor.

Rock breathers, for example, can expel electrons onto a mineral or electrode. To synthesize your knowledge and understanding of respiration, photosynthesis, and the rock eaters that Dr. Annie Rowe studies, match the following processes with their electron donors.
Biology
1 answer:
astraxan [27]3 years ago
4 0

Answer:

Photosynthesis and respiration are reactions that complement each other in the environment. They are in reality the same reactions but occurring in reverse. While in photosynthesis carbon dioxide and water yield glucose and oxygen, through the respiration process glucose and oxygen yield carbon dioxide and water.

Explanation:

Photosynthesis makes the glucose that is broken down by cellular respiration. Cellular respiration converts the glucose that is made by photosynthesis to oxygen. Photosynthesis converts the glucose that is made by cellular respiration to carbon dioxide

You might be interested in
Which answer choice demonstrates how people could create less pollution and protect the habitats of animals and plants?
Reptile [31]

Answer: is it A someone tell me im doing it right now

Explanation:

6 0
2 years ago
Read 2 more answers
Which type of organism creates the original source of energy for nearly every ecosystem on Earth?
tekilochka [14]
A.) producer
Good luck!!
7 0
3 years ago
Read 2 more answers
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
Radioactive isotopes in fossils decay at a constant rate. The ratio of radioactive isotope to stable isotope can be examined to
Klio2033 [76]
The answer would be known as absolute dating
8 0
2 years ago
Read 2 more answers
In peas, yellow seed color (Y) is dominant to green seed color (y). A homozygous green pea plant is crossed with a heterozygous
inysia [295]
A0 50 percent yellow, 50 percent green
9 0
3 years ago
Read 2 more answers
Other questions:
  • Which tool would be likely to provide the most accurate measurement of time in a laboratory experiment involving sprinting times
    15·2 answers
  • Why is cellular respiration a continuous process? What would happen if it suddenly stopped?
    10·1 answer
  • Which of the statements is accurate?
    11·1 answer
  • Which of the following statements about fluid movement is NOT correct?
    12·1 answer
  • How is energy lost as it moves through a food web
    13·2 answers
  • Your tongue is home to special structures that allow you to experience tastes such as sour, sweet, bitter and salty, what is the
    7·1 answer
  • Glucose provides energy for cells. Different cells have different mechanisms for glucose intake. Intestinal cells contain protei
    15·1 answer
  • Acid rain can have a pH between 1.5 and 5.0. The effect of acid rain on the environment depends on
    9·1 answer
  • While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that thi
    14·1 answer
  • The Michaelis-Menten and the Lineweaver-Burk plots can be used to determine the Km and Vmax of the enzyme-catalysed reaction. Ex
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!