1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergeinik [125]
3 years ago
13

1. Suppose the country is going through a period of economic contraction. What kinds of

Biology
1 answer:
Mademuasel [1]3 years ago
4 0

Answer:

Increase in prices of commodity

Scarcity of petroleum

Economic recession

Lack of social amenities e. G water and light

Explanation:

Am not so sure tho but I think I've helped a bit with this

You might be interested in
Plants are green because they contain the protein chlorophyll. A bucket was left on the lawn for one week. When the bucket was r
Aleksandr [31]

Answer:

The amount of ⛅ sunlight .

Explanation:

PLEASE MARK AS BRAINLIEST

8 0
3 years ago
As an infant, the ability to produce antibodies is
aleksandr82 [10.1K]
NOT POSSIBLE!AT ALLLLL
5 0
3 years ago
New generations are better suited to their environment than the first generation. What is this called?
olchik [2.2K]

Answer:

Descent with modification

Explanation:

We define evolution as descent with modification from a common ancestor.

Evolution only occurs when there is a change in gene frequency within a population over time. These genetic differences are hereditary and can be passed on to the next generation - which is what really matters in evolution: long-term change. In this process, the new generations are better suited to their environment than the first generation because of descent with genetic modification.

7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
1. What 3 things does a cell membrane do?<br> a.<br> b.<br> c.
morpeh [17]

Answer:

look below

Explanation:

1) keep toxic substances out of the cell

2) allows certain minerals in that are needed and keeps others out and uses reciptors to do so

3) they separate vital but incompatible metabolic processes conducted within organelles

6 0
3 years ago
Other questions:
  • 1. How is pressure related to force and surface area?
    13·1 answer
  • If you were homozygous dominant for hitchhiker thumb, what is your genotype?
    9·2 answers
  • What would occur if exponential growth occurred in a population
    12·1 answer
  • Does glucose actually react with oxygen during cellular respiration? explain
    9·1 answer
  • What general type of microscope uses bright illumination and multiple glass lenses?
    7·2 answers
  • Is Glycogen a long term energy carbohydrate?
    7·1 answer
  • Which biome contains large populations of grazing herbivores, few species of birds, and deep, rich soil?
    6·1 answer
  • Rearrange the information into a food chain. Label the role of each organism in the chain.
    14·1 answer
  • Look at the teeth in the lions mouth. how is the structure of the lions teeth an adaptation
    8·1 answer
  • two genes are involved in determining the color of a species of foxglove flower. the dominant allele of the m gene produces a li
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!