1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maslowich
3 years ago
11

What is part of the carbon cycle

Biology
1 answer:
poizon [28]3 years ago
6 0
The carbon cycle describes the process in which carbon atoms continually travel from the atmosphere to the Earth and then back into the atmosphere. ... Humans play a major role in the carbon cycle through activities such as the burning of fossil fuels or land development.
You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
PLEASE HURRY !!
adelina 88 [10]

Answer:the gizzard

Explanation:I know a lot about birds

3 0
3 years ago
Read 2 more answers
Explain why the daughter cells of meiosis are genetically different from each other but the daughter cells produced by mitosis a
Ganezh [65]

The daughter cells produced from Meiosis are genetically different from each other due to the process of Crossing Over in the stage of Prophase I.


In Mitosis, there is no Crossing Over involved, since it is intended to help the body in growth and repair, not in reproduction.


Genetic Variation is important for reproduction so that not all offspring look exactly like each other or so that they do not look exactly like their parents.

5 0
3 years ago
Please help meeee!!
FinnZ [79.3K]

Answer: i answered the first one you posted go check

Explanation:

7 0
3 years ago
The first phase of mitosis is called
Vikki [24]
The first stage of mitosis is prophase.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Human processes mainly contribute to the
    9·2 answers
  • What is an example of the human body keeping blood sugar levels within a fairly narrow range despite the intake of meals high in
    5·1 answer
  • The four bases contained in dna are _____. the four bases contained in dna are _____. cytosine, guanine, thymine, uracil adenine
    14·1 answer
  • How do some protozoans respond to adverse environmental conditions ?
    14·1 answer
  • What happens to RNA polymerase II after it has completed transcription of a gene? a. It begins transcribing the next gene on the
    8·1 answer
  • When listing the levels of organization in organisms from least complex to most complex, which level is just below
    9·1 answer
  • Where on the track is the most potential energy?
    15·2 answers
  • Why would the location of resources be a concern?
    8·2 answers
  • 1. Why is the oceanic crust easily broken?
    11·1 answer
  • A population of 2000 seals produces 950 young in one year. In the same period of time, 150 seals die. If 50 seals leave the popu
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!