1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
11

1. Look at the Image called Judicial Referees.This political cartoon best depicts what important government concept

Law
1 answer:
maksim [4K]3 years ago
6 0
1. The political cartoon best depicts America’s government concept, which is known as Separation of Powers and / or Checks & Balances. This means that there are multiple branches of government (3 in the U.S. system), and they all fulfill their respective, separate duties. Although they work on relatively different matters or at least do things differently, they may “check” on each other to ensure that the other branch(es) are doing what they’re supposed to do.

2. The Legislative Lions represent the legislative branch, also known as the U.S. Congress. The Congress consists of the House of Representatives and the Senate, and their job is primarily to make laws, consider confirming cabinet / government appointees (Only the Senate), declare war if necessary, provide money, approve treaties, impeach and remove an office holder if necessary, and other legislative duties.

The team called Executive Eagles represent the Executive Branch. The Executive Branch is known for the U.S. President. The President works in the Executive Branch, as does his Vice-President, cabinet and other federal government employees. The Executive Branch is run by the President, who’s job is to sign or veto (deny) any laws passed by Congress, sign treaties, enforce the laws passed by congress and signed by the President, represent the United States abroad, lead the U.S. Armed Forces, and overall, be the head leader of the USA, from a vision standpoint.

Hope this helps.
You might be interested in
Is legal studies worth it ? Is it easy or hard ? I am scare and worried tbh !!!!! I am actually going to choose that subject so
fgiga [73]

Answer:

Yes legal studies is worth it!

Explanation: any learning experience you have should be a good one, it might be a challenge  depending how fast you learn.

7 0
3 years ago
I need help with this ASAP !
Reika [66]
Which one do u need help with?
4 0
3 years ago
Read 2 more answers
An officer grabs a reluctant suspect by the arm and escorts the suspect to the police
Leviafan [203]

Answer:

hard hand

Explanation:

7 0
3 years ago
Explain the sources of each type of law and provide examples of each:
Anna [14]

Answer:

80 inches^2

80 inches^2

80 inches^2

80 inches^2

80 inches^2

Explanation:

80 inches^2

80 inches^2

80 inches^2

80 inches^2

80 inches^2

3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Civil law addresses activities and conduct harmful to society and is actively enforced by the state. _________________________
    10·1 answer
  • List and explain the major types of legal defenses.
    11·1 answer
  • HELPPPP WITH THIS , IS URGENT , I CAN FAIL THE COURSE
    10·1 answer
  • Lime green Balenciaga or air vapormax red and black
    14·1 answer
  • Which of the following statements is CORRECT regarding fatigue, medication, drugs, or illness?
    9·2 answers
  • How can you drop two eggs the fewest amount of times, without them breaking?
    15·2 answers
  • Why are ethical constraints important in practicing medicine?
    8·1 answer
  • Identify two reasons why you agree or disagree with structural functionalism<br><br> -Sociology
    10·1 answer
  • How long would this case be eligible for prosecution based on the new california law?
    6·1 answer
  • Which describes a campaign?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!