1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
densk [106]
3 years ago
9

Do viruses contain some sort of genetic material?A. TrueB. False

Biology
2 answers:
jek_recluse [69]3 years ago
8 0

Answer:

A. True

Explanation:

Most viruses have either RNA or DNA as their genetic material. The nucleic acid may be single- or double-stranded. The entire infectious virus particle, called a vision, consists of the nucleic acid and an outer shell of protein. The simplest viruses contain only enough RNA or DNA to encode four proteins.

igor_vitrenko [27]3 years ago
3 0

Answer:

True

hope this helps

have  a good day :)

Explanation:

give the other person the crown

You might be interested in
• Homologous structures show ____ _____ on a____ anatomical theme. These are seen in organisms that are____ related. Give an exa
krek1111 [17]

Explanation:

Homologous structures show individual variations on a common anatomical theme. These are seen in organisms that are closely related. 1. Give an example of a homologous structure from this activity: Crocodile

8 0
3 years ago
I need someone to write me an essay, please. Describe the different types of cellular transport and explain how the structure of
bearhunter [10]

Answer:

Some cells function best at a pH of 5, while others are better at pH 7. ... control what crossed their membranes, either no molecules would make it across, ... Various types of cell transport are summarized in the concept map in ... Figure 5.7.5 demonstrates the specific outcomes of osmosis in red ...

Explanation:

7 0
1 year ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Use examples to explain how the geosphere interacts with two other of Earth's spheres. Explain the interaction for each using co
svetlana [45]

Several examples of sphere interactions can be inferred from this photograph: Humans (biosphere) built a dam out of rock materials (geosphere). Water in the lake (hydrosphere) seeps into the cliff walls behind the dam, becoming groundwater (geosphere), or evaporating into the air (atmosphere).

<h3>(PLEASE MARK ME AS BRINLIEST)</h3>

7 0
3 years ago
As a fishery scientist, you notice that very few cod fish have been caught in the past year. You still see very young and larval
Trava [24]

Explanation:

1 Protection

2. Not getting caught for a few years

3 Deployment of Supervisors by the Government

8 0
3 years ago
Other questions:
  • Apply your knowledge of probability to explain why a drop of food coloring in a glass of clear water spreads out so that all of
    13·1 answer
  • Is leucoplast found in prokaryotic cells or eukaryotic cells or both
    5·1 answer
  • How would you expect the attenuation of light (like with increased turbidity) to influence net productivity? Why?
    13·1 answer
  • A gene that normally has the sequence CAGAGCCTATTAGGC is replicated as CAGAGCTTATTAGGC. Which of the following repair mechanisms
    7·1 answer
  • Can a car run on dinosaurs
    12·2 answers
  • All the offspring of a cross between a RED-flowered plant and a WHITE-flowered plant have PINK flowers (blending of traits/inter
    11·1 answer
  • Which phrase best describes carbon-14 dating?
    7·2 answers
  • ❗️❗️EARTH SCIENCE CLASS ❗️❗️Climate factors are the things that established and have changed the Earths climate for billions of
    13·1 answer
  • Assume a snake must eat 5 grasshoppers per day, while an eagle must eat 2 snakes per day. how many blades of grass are needed to
    14·1 answer
  • Transposable elements can induce mutations by all of the following mechanisms EXCEPT: disrupting a gene when inserted into it. f
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!