3 years ago

(-4) + (-4) + 6+6+5 + 5

Biology

2 answers:

Licemer1 [7]3 years ago

7 0

Answer: 14

Explanation:

(-4) + (-4) + 6+6+5 + 5

Recall that BODMAS rule must be obeyed

Address bracket first, and note that plus sign multiplied by minus sign becomes minus

so, (-4 - 4) + 6+6+5 + 5

(-8) + 6+6+5 + 5

= (-8) + 6+6+5 + 5

= (-8) + 22

= 14

Thus, the answer is 14

topjm [15]3 years ago

5 0

The answer of your question is 14

You might be interested in

Help I'm confused!

aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0

3 years ago

_____ switch on enzyme activity, while ____ can switch off or reduce enzyme activity. activators; inhibitors inhibitors; activat

Arisa [49]

Answer: <u>Activators </u> can switch on enzyme activity, while <u>inhibitors </u>can switch off or reduce enzyme activity.

Enzymes are biomolecules that catalyzes a reaction. The enzymes can either speed up or slows down a reaction. Activators are compounds, molecules or elements that attach to the enzyme and promotes its activity. Inhibitors are factors which prevent the activity of the enzyme. Both activators and inhibitors are necessary for cellular metabolisms taking place in a living organism.

7 0

3 years ago

Read 2 more answers

How long ago did the last ice age end

natta225 [31]

Answer:

11,700 years ago

7 0

3 years ago

Complete the sentences from George Bernard Shaw's the doctors dilemma with word

diamong [38]

Answer:ohhh naaaa