If two heterozygous individuals are crossed, the results of the cross are as follows:
- SS - spotted condition
- 2 Ss - Spotted condition
- ss - non-spotted condition
<h3>What is an Heterozygous Cross:</h3>
According to this question, the gene coding for spotted condition. The allele for spotted condition (S) is dominant over the non-spotted condition (s).
If two heterozygous Dalmatian dogs are crossed i.e. Ss × Ss, the allele combination for each gamete is as follows:
The following offsprings will be produced:
- SS - spotted condition
- 2 Ss - Spotted condition
- ss - non-spotted condition
Learn more about heterozygous cross at: brainly.com/question/13050360
A biotic factor is a living thing that has an impact on another population of living things or on the environment. Abiotic factors do the same thing, but they are non-living. Together, biotic and abiotic factors make up an ecosystem. To survive, biotic factors need abiotic factors.
Answer:
Continental crust is typically 40 km (25 miles) thick, while oceanic crust is much thinner, averaging about 6 km (4 miles) in thickness. The effect of the different densities of lithospheric rock can be seen in the different average elevations of continental and oceanic crust.
Explanation:
It should be
AGATACCATGGTTACCCGGTTCCA
