The principle is called CEPHALOCAUDAL PRINCIPLE.
This principle proposed that growth follow a particular pattern in which the head and the upper part of the body grow first before the growth proceeds to other part of the body.
Answer:
Prenatal.
Explanation:
The sexual reproduction may be defined the process of fusion of the male sperm and female ovum that leads to the formation of the zygote. Zygote is diploid in nature.
The prenatal development includes all the stages that are involved in the development of the single cell till the completion of the nine months of the fetus. The development of all organs and the process of the cell specification all occurs in the prenatal development stage.
Thus, the answer is prenatal.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Evolution Due to environmental factors, It may not look it, but, needles are leaves, they collect solar radiation to produce glucose through the process of photosynthesis, however, needles are, some would say, evolutionary superior to leaves. Needles themselves hold in more water due to their dense wax coating, they are very difficult for insects and other organisms to eat, one because of their structure, and two because of their acidity, they can catch sunlight all year long due to their winter resilience( they don't fall, during the winter), and they have less surface area for wind to catch, which leaves them better protected from wind than most deciduous trees, however the surface area can also pose a larger problem for less surface area means less sunlight interception, therefore more are needed to compete against regular leaves. But.. I Digress... Plant needles are 'PROBABLY' initially the result of evolution of narrow leaves due to climate or environmental factors.
Sry its so long got carried away! Hope this helps xD
Unwanted pregnancy or std ( sexually transmitted disease <span />