1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
12

Animals have four basic types of : nervous, epithelial, muscle, and connective.

Biology
1 answer:
alexandr402 [8]3 years ago
7 0
Answer: muscle




Explanation:
You might be interested in
What is the name of the principle that is based on greek and latin roots meaning "head-to-tail"?
telo118 [61]
The principle is called CEPHALOCAUDAL PRINCIPLE.
This principle proposed that growth follow a particular pattern in which the head and the upper part of the body grow first before the growth proceeds to other part of the body. 
6 0
3 years ago
The developmental period during which a being grows from a single cell to an organism complete with brain and behavioral capabil
Radda [10]

Answer:

Prenatal.

Explanation:

The sexual reproduction may be defined the process of fusion of the male sperm and female ovum that leads to the formation of the zygote. Zygote is diploid in nature.

The prenatal development includes all the stages that are involved in the development of the single cell till the completion of the nine months of the fetus. The development of all organs and the process of the cell specification all occurs in the prenatal development stage.

Thus, the answer is prenatal.

4 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
In the early days of life on Earth, plants were exposed to extremely high doses of ultraviolet radiation. Constant UV exposure r
aliina [53]
Evolution Due to environmental factors, It may not look it, but, needles are leaves, they collect solar radiation to produce glucose through the process of photosynthesis, however, needles are, some would say, evolutionary superior to leaves. Needles themselves hold in more water due to their dense wax coating, they are very difficult for insects and other organisms to eat, one because of their structure, and two because of their acidity, they can catch sunlight all year long due to their winter resilience( they don't fall, during the winter), and they have less surface area for wind to catch, which leaves them better protected from wind than most deciduous trees, however the surface area can also pose a larger problem for less surface area means less sunlight interception, therefore more are needed to compete against regular leaves. But.. I Digress... Plant needles are 'PROBABLY' initially the result of evolution of narrow leaves due to climate or environmental factors. 

Sry its so long got carried away! Hope this helps xD
7 0
3 years ago
Read 2 more answers
Sometimes young adults may want to experience physical intimacy, and their lack of knowledge may result in
olganol [36]
Unwanted pregnancy or std ( sexually transmitted disease <span />
5 0
3 years ago
Other questions:
  • Attached earlobes are a reccesive trait in humans. in the tree below, people with attached earlobes are shaded in. which best de
    11·1 answer
  • How does the water cycle purify water samples?
    6·2 answers
  • Number the following levels of organization in order from the simplest to the most complex : atoms of elements, biological commu
    9·1 answer
  • What will happen if a new genotypic character is introduced in a population?
    13·1 answer
  • The process of breaking down food to yield energy.
    13·1 answer
  • Quick Please !!!!! Farmers take water from a pond to water their crops. The farmers notice fish begin to die after the removal o
    5·1 answer
  • Match the following terms and definitions. 1. a seed leaf dicotyledon 2. a flowering plant with seeds that have two seed leaves
    14·2 answers
  • The relationship between the bacterium Xenorhabdus nematophila and its nematode host, Steinernema carpocapsae, is classified as
    12·1 answer
  • A component of a circuit changes, as shown below. How would this change affect the electric circuit? A switch is closed, so the
    11·2 answers
  • Assuming that a person going to community college can't afford to go to a four-year college is an example of a) a generalization
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!