1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
2 years ago
10

Hello may u pls help me with this I'm hella counfused

Biology
2 answers:
pantera1 [17]2 years ago
7 0

Explanation:

(1) Is referring to Newton's first law, an external force (gravitational force) is applied to frogs motion, thus causing it to deviate from a straight line

(2) is referring to Newton's third law of motion, the action force is done by the ball hitting the ground and the direction is downwards, the reaction force is done by the ground transferring that same force to the ball, acting upwards

(3) I think it's also the first law, the person on a train is showing, the force to keep it at rest, the sudden halt of the train causes a reaction force to act on the person, does making the person move

(4) I think it's both Newton's second law and third law motion.

I hope these helps

mr_godi [17]2 years ago
3 0

Answer:

(1) Is referring to Newton's first law -it will remain at rest or keep moving in a straight line at constant speed unless it is acted upon by a force.

(2) is referring to Newton's third- law for every action (force) in nature there is an equal and opposite reaction

(3) I think it's also the first law -it will remain at rest or keep moving in a straight line at constant speed unless it is acted upon by a force.

(4) Newton's second law and third law motion-for every action (force) in nature there is an equal and opposite reaction the acceleration of an object is directly related to the net force and inversely related to its mass

Explanation:

mark me brainy plz!!!!!!!!!!!!!!!!!!!!!!!!!!!

You might be interested in
Insulin is released into the blood when (1 point) blood-glucose levels are low. oxygen levels are low. blood-glucose levels are
Dennis_Churaev [7]
Insulin is released into the blood when oxygen levels are low and blood glucose levels are high 
8 0
3 years ago
(50 points) Unit 4: Activity: Mendelian Genetics
ki77a [65]

ΔπФω∵∴⊅⊄⊇⊆⊃⊂∠∅║∦≥≤∝j

7 0
2 years ago
Read 2 more answers
All living things contain carbon.which of the following statements is true about carbon atoms?
vfiekz [6]

I. Each carbon atom can form single bonds with up to four other carbon atoms. II. Each carbon atom can form double bonds with up to two other carbon atoms. III. Carbon atoms can join together to form chains or rings. IV. A single molecule of some compounds can contain thousands of carbon atoms.

Answer:

All the given choices

Explanation:

Carbon is a very interesting element which is the backbone of most organic compounds.

Organic compounds are made up of carbon. Carbon forms a wide range of compound due to the following properties;

  • An atom of carbon has 4 valence electrons and can bond with 4 other carbon.
  • Carbon can form single, double and triple covalent bonds.
  • They can join together to form rings or chains.
6 0
3 years ago
Which is not a compound?<br> 8H2<br> H2O<br> 6CaO<br> 5HCl
poizon [28]
8H2. The actual equation doesn't make sense for 8H2. This is because in compounds it always says the number of atoms after the element symbol, but in this case, there is an 8 before it. This means that it isn't a compound. 
3 0
3 years ago
Read 2 more answers
I NEED AN ANSWER ASAP<br> What is an example of stewardship??<br> THANK YOU SO MUCH!!
kati45 [8]

Stewardship is taking care of something like a large household, the arrangements for a group or the resources of a community. An example of stewardship is the responsibility of managing the staff of an estate. An example of stewardship is the act of making wise use of the natural resources provided by the earth.

3 0
3 years ago
Other questions:
  • Please help, I think it is C?
    10·2 answers
  • The phenomenon where rare traits are found in abundance in a new or recently isolated location is called
    15·1 answer
  • How does DNA help with the transfer of genetic material from parents to offspring? A. Enzymes break down DNA, releasing amino ac
    15·2 answers
  • Why should water pipes in houses be well insulated so that they are not likely to freeze in winter
    14·2 answers
  • Which of the following information could be included in the description of a grasshopper’s niche, but not in a description of it
    9·1 answer
  • True or false identify if it is false: wetlands flood peoples homes and also filled with freshwater thats good for the aquatic l
    7·1 answer
  • I WILL GIVE BRAINLIEST!!!
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How does the hurricane decrease in<br> strength/intensity?
    11·2 answers
  • The Frye and Edidin experiment demonstrated that lateral protein movement within the membrane is affected by
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!