1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
3 years ago
9

Write two differences between the unicellular and multicellular organisms.

Biology
2 answers:
UNO [17]3 years ago
6 0

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

Unicellular organisms are made up of only one cell that carries out all of the functions needed by the organism, while multicellular organisms use many different cells to function. ... Multicellular organisms are composed of more than one cell, with groups of cells differentiating to take on specialized functions

vlabodo [156]3 years ago
4 0

Answer: The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

Cell membrane, also called plasma membrane, thin membrane that surrounds every living cell, delimiting the cell from the environment around it.

You might be interested in
Name the following compound: Mg3(PO4)2
Nataly [62]
Magnesium Phosphate is the answer
3 0
3 years ago
Read 2 more answers
In a study published in the journal Nature, scientists studied eight ponds in Florida: four that were populated by a species of
AlexFokin [52]

Answer: the rate of pollination of flower, in a field next to a pond with no fish, will DECREASE.

Explanation:

POLLINATION is defined as the process by which flowering plants, through the aid of external agents such as insects,wind, water and other animals, are able to transfer pollen grains from an anther to a receptive stigma. Insects are the most common pollinators. They visit flowers to obtain nectar and pollen as source of food. Flowers use various features, such as colour and scent, to attract and guide insects to the food source within them. In the process of reaching their source of food, insects bring about pollination.

From the study conducted by scientist in Florida, eight(8) ponds where subjected to the the study. The first four (4) ponds had species of fishes that fed on dragonflies and dragonfly larvae, hence the reason for a decrease in the population of the dragon flies in the area around it. While the remaining four (4) ponds had NO fish and the area around it is populated with dragonflies and dragonfly larvae. This is so because of the absence of fish.

It was then noted that the dragon lies fed of the insect pollinators such as the bees and butterflies. Since these dragonflies and its larvae are abundant in the field which is close to the pond with no fish, they will grossly depend on the insect pollinators as their source of food thereby decreasing the rate of pollination in the field next to the pond with no fish.

7 0
3 years ago
Study the following food chain : grass>rabbits>snakes>hawks.From this chain, you can correctly assume that each populat
masha68 [24]
The answer is D, for when one tropic level is eaten by the tropic level above it, the tropic level is supporting the higher one. I. E. Rabbits are supported by the grass because rabbits eat the grass. Also, the grass population would be larger than rabbits, the rabbits larger than snakes, so on and so forth, so B is ruled out. B states that each population is larger than the one BEFORE it, but there is no way there would be more rabbits than grass. Also, there are both herbivores and carnivores in the food chain, so A and C are out. The best answer is D.
8 0
3 years ago
An operational definition is used for a behavior so that
dezoksy [38]

An operational definition is used for a behavior so that the behavior can be properly described and understood. Without an operational definition, it would be difficult to describe behavior without being subjective. Therefore, behavior cannot be understood and cannot be correctly addressed. It is also important to understand how behavior functions so that the antecedents and consequences of behavior can be observed. Thus, what reinforces or affects the behavior can be better understood. Lastly, an operational definition is objective and specific, therefore, behavior can be described across different settings and times.

8 0
4 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Loggerhead sea turtles love to snack on jellyfish. Unfortunately, plastic bags and the plastic rings off a six pack of drinks lo
    12·1 answer
  • Where can salt marshes be found?
    8·1 answer
  • Most biologist use six kingdoms into which they organize all living things
    8·1 answer
  • What is the job of the tendons
    14·2 answers
  • How many planets are there in the solar system?
    15·2 answers
  • A scientist is trying to find a method to artificially produce a protein that is found in a chicken' s liver. Once the scientist
    7·2 answers
  • Why pollen is important in fertilization?
    13·1 answer
  • How do upwelling currents near the shore affect the abundance of aquatic organisms along the shoreline?
    12·1 answer
  • Suppose a mutation occurs within the cells of a Great Blue Heron. The Mutation could be.
    10·1 answer
  • What is the meaning of DNA​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!