Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary <u>DNA strand</u>.
<h2>Biodiversity hotpots</h2>
Explanation:
All of the given option can be the biodiversity hotspots EXCEPT:
Tundra biome.
Biodiversity is defined as the total number of species present within a biogeographic region.
A biodiversity hotspot is that geographic area where significant biodiversity exists.
A tropical biome, a mountain ecosystem and an island ecosystem can have a significant biodiversity depending on the climate and other environmental condition.
A tundra biome is totally covered with snow and have a very few areas of vegetation and could support only a few species So it cannot be a choice for Biodiversity hotspot.
Analogous structures are structures that are similar in unrelated organisms. The structures are similar because they evolved to do the same job, not because they were inherited from a common ancestor. For example, the wings of bats and birds, shown in Figure below, look similar on the outside.
When continents broke apart from Pangaea lots of different species got separated to different parts of the world. The animals and other living things had to have learned how to adapt to the different climates or they would die and go extinct.
elliptical is what they are called