1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
3 years ago
14

Fill in the blanks

Biology
1 answer:
Setler79 [48]3 years ago
3 0

Answer:

completely

EXPLANATION

You might be interested in
Is a threadlike form of genetic material loosely dispersed throughout the nucleus when a cell is not dividing?
lord [1]
Chromatin is the threadlike form of genetic material in the nucleus.
 
(chromatin coils around histone proteins and form chromosomes when mitosis/meiosis are going to occur)
3 0
3 years ago
To say that species a is more closely related to species b than to species c is to say that a and b?
slega [8]

yes, because its close to a and b.

5 0
3 years ago
Jimmy and Denise are planning their wedding and working on their budget. What percentage of their total budget should be used fo
Korvikt [17]

Answer:

O is your anwser

Explanation:

8 0
3 years ago
Read 2 more answers
What part of the world is acid rain a problem
Katen [24]
Answer: Anywhere near water (rivers, downstreams, oceans, etc.)
5 0
3 years ago
The earth's systems are composed of 5 spheres. They include the atmosphere, cryosphere, hydrosphere, geosphere and the _________
bezimeni [28]
The answer is hemisphere
4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • You cut yourself on a knife while cutting vegetables. Look at each statement below and decide which of these is true about how y
    9·1 answer
  • About how much cholesterol is synthesized by the liver every day?
    5·1 answer
  • Water is made up of three atoms of two elements, Two hydrogen, and one Oxygen. Which of the following is true of this compound?
    9·1 answer
  • What is tissue rejection?
    5·1 answer
  • How blood pressure affects blood flow
    6·2 answers
  • Does anybody know what kind of rock/ crystal this is because I can’t tell if this a amethyst in side a rock. I had this rock for
    5·1 answer
  • The way an organism appears is called the
    5·1 answer
  • 1. It takes 29.5 days for the Moon to orbit Earth. How many days and hours does it take
    7·1 answer
  • Describe an experiment to show oxygen is given up during photosynthesis​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!