Answer:
1. 80 chromosomes are found in each of the daughter cells. 2. Two daughter cells are produced. 3. The daughter cells are identical to each other.
Explanation:
Mitosis is simply a process of cell division whereby two daughter cells that are genetically identical are produced from a single parent cell. A cell having 80 chromosomes would undergo Mitosis through these various stages:
Interphase: This can be referred to as the rest phase between cell division when mature enough for reproduction. This is a preparatory stage where DNA is duplicated and ready for the division of chromosomes
Prophase: This stage marks the beginning mitosis of the cell with 80 chromosomes. The chromatin threads start a coiling process in which the chromosomes become condensed to enable easy distribution to daughter cells without tangling.
Prometaphase: This phase commences toward the end of the prophase, where the nuclear envelop breaks down. The chromosomes move toward to the center of the cell.
Metaphase: At this stage, the duplicated chromosomes line up on the mid plane or equator of the cell. During this stage, each chromatid is condensed completely and appears thick and distinct.
Anaphase: At this stage, the chromosomes move toward the poles as each replicated copies of the DNA of the cell ends up on either side of the cell. What we would have here at this stage is an entirely two new sister chromatid having 80 chromosomes. Cytokinesis begins towards the end of this stage as the parent cell cytoplasm divides which also continues at telophase.
Telophase: This is the final phase of Mitosis where two separate nuclei are formed and Cytokinesis takes place to complete the division of the cell to form two daughter cells having the same number of chromosomes. These cells are genetically identical to the original parent cell.
<span>the interference of two waves of equal frequency and opposite phase, resulting in their cancellation where the negative displacement of one always coincides with the positive displacement of the other.</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Identity Diffusion
Explanation:
A person whose identity status is Diffusion has not had an identity crisis and has not yet fully realized their social identity or personal traits. Moreover, this person is not seeking to make a commitment to establish his or her identity. It is almost like identity Foreclosure; however, in that stage, the person adopts some traits and qualities of friends and parents.
A cell is the smallest unit of living matter
