1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RideAnS [48]
1 year ago
13

what is the order of three genes (x, y, and z) that are located on the same chromosome, based on the following information? gene

s x and y have a recombination frequency of 17%. genes y and z have a recombination frequency of 9%. genes x and z have a recombination frequency of 8%.
Biology
1 answer:
Mekhanik [1.2K]1 year ago
3 0

The recombination frequency between genes is useful to determine the distance between genes and their order in the chromosome. The correct order of genes in this chromosome is X-Z-Y.

<h3>What is the recombination frequency?</h3>

Recombination frequency refers to the probability of crossing-over events occurrence between two genes. There farther genes are from each other, the greater recombination frequency there will be.

Recombination frequencies are also used to determine the distance between genes, and if they are linked or not.

So, if we know the recombination frequencies, we can calculate the distances between the genes and figure the genes' order out.

The map unit is the distance between the pair of genes for which one of the 100 meiotic products results in a recombinant one.

1% of recombination frequency, RF = 1 Map Unit, MU = 1 centiMorgan, cM

Now let us analyze the data

  • Three genes ⇒ X, Y, Z.
  • Distance between X-Y = 17% = 17 MU
  • Distance between Y-Z = 9% = 9 MU
  • Distance between X-Z = 8% = 8 MU

When the RF is given, we already have the distance between genes.

Now, to put these genes in order, we need to look for the most distant genes. These are probably the ones placed at the extremes of the chromosomal fragment.

In this case, the most distant genes are X-Y. So,

---------X-----------------Y---------

                  17 MU

Then, we need to place the remaining genes, which are probably between the two extremes genes. To be sure of this position, the addition of these middle genes must equal the distance between the extreme genes.

In our example, we only have one remaining gene Z.

  • The distance from X to Z = 8 MU
  • The distance from Y to Z = 9 MU
  • 9 MU + 8 MU = 17 MU which is the distance between X and Y (extreme genes)

-----------X-------------Z----------------------Y---------

           ║----8MU---║------- 9 MU -----║

           ║-------------17 MU ---------------║

So, according to this reasoning, the correct order of genes in this chromosome is X-Z-Y.

You can learn more about the recombination frequency at

brainly.com/question/13243739

brainly.com/question/20713958

brainly.com/question/11105396

#SPJ1          

You might be interested in
Which fuel has the shortest span of renewability?
Arte-miy333 [17]
<span> It's solar, because s</span>olar energy is a renewable resource that is virtually endless as long as the sun shines.<span />
6 0
3 years ago
Read 2 more answers
Which of the following describes a pod?
svp [43]
Both answers C. and D. are correct. Most marine animals live in pods like seals, whales, and walrus. A. is called a school of fish while B. is a colony of penguins. :(
6 0
3 years ago
At which stage is glucose broken into smaller molecules? A. before cellular respiration begins B. during the first stage of cell
Vesnalui [34]

b. the first stage because it could never be in the secound stage

8 0
3 years ago
Read 2 more answers
Long-term activation by nuclear receptors differs from the more transient membrane receptor signaling for what reason
Rama09 [41]
I have no idea but i think because long term activation is long term rather than nuclear. this is wrong
6 0
3 years ago
They can use in sweat glands both work to prevent excesses of
Dimas [21]
Salt or bad products that enters ur body
6 0
3 years ago
Other questions:
  • How do adaptation Help organism survive?
    15·1 answer
  • The ocean absorbs carbon dioxide directly from the atmosphere. How does CO2 absorption affect the ocean?
    8·1 answer
  • The power stroke describes: All of these choices are correct. a) the cocking of the myosin head by hydrolysis of ATP. b) the cyc
    15·1 answer
  • 8. The kinetic energy of an object depends
    15·1 answer
  • What two places in the body are cartilaginous joints found?
    12·1 answer
  • What is a control in an experiment
    15·2 answers
  • Which of the following represents an activity within a population?​
    10·1 answer
  • Gene therapy can be used to treat disorders that do not have a present cure. <br> true or false?
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following phrases best describes the function of meiosis
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!