1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
15

Charles darwin viewed the fossil record as

Biology
2 answers:
padilas [110]3 years ago
6 0

Charles Darwin viewed the fossil record as evidence that traits are acquired through use or disuse.

Further Explanation:

Darwin purposed a theory of evolution in which the species can give rise to a new species within a very short span by an evolutionary jump. Sudden changes seen in fossils developed due to changes in the geological record. It is suggested that some organ or parts of a particular organism can develop or transform by its requirements in daily life.

A very common example of this is that a giraffe get its long neck because of reaching to the tree that give or provide its food. Another example is the leg of a human which developed because of it requirement in walking. It was believed that the parts of the organism did exist or did disappear depends on it used or it was necessarily needed to survive.

Learn more:

1. Learn more about the abiotic factor brainly.com/question/1561256

2. Learn more about the cellular respiration brainly.com/question/8900186

3. Learn more about the primary and secondary succession brainly.com/question/4723069

Answer Details:

Grade: High School  

Subject: Biology

Chapter: Ecology

Keywords:

Fossils, record, walking, human, leg, giraffe, long, neck, food, survive, theory, evolution, jump, organism, geological, sudden, changes, organ, species.

Reil [10]3 years ago
4 0
<span>D. evidence that are acquired through use or disuse. Since it is believed that some parts of an organism developed through its need. For example a giraffe got its long neck becuase of reaching for a tree that could produce its food. Another example is the leg of a human which developed because of its need to walk. It was believed that the parts of the an organism did exist or did vanish depending if it was no longer used or it was necessarily needed to survive.</span>
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
How will the change in pH impact the functioning of cells? (Hint: Explain which biomolecules and what types of bonds in these bi
Effectus [21]

Answer:

A change in pH will cause many cellular processes to be disrupted because they affect the biomolecules (protein and nucleic acid) responsible for these processes.

Explanation:

pH refers to the degree of acidity or alkalinity. In a cell, the structures and processes that occur in them are impossible without the biomolecules, which are carbohydrate, protein, lipids and protein.

However, unfavorable conditions like a change in pH can cause the structure of some of these biomolecules to be affected. Proteins are made up of amino acids, which gives them their shape that is peculiar to their functioning. Also, nucleic acids such as DNA are composed of nucleotides responsible for their functioning.

A change in pH will cause the bonds of the protein to be disrupted, hence altering its shape and ultimately its functioning. Likewise, the hydrogen bonds in the DNA will be broken in the presence of a high pH causing the DNA to be dysfunctional.

When these biomolecules are affected, the vital functions that they perform in a cell, which is key to the cell's survival are disrupted) are likewise affected. Therefore, the cell is affected negatively.

8 0
3 years ago
Which factors improve soil fertility
Ulleksa [173]
I think the answer is water
4 0
3 years ago
Which of the following statements apply to the variation in human skin color? Select all that apply.
miskamm [114]
Skin color<span> is due primarily to the presence of a pigment called melanin , which is controlled by at least 6 genes. Both light and dark complexioned people have melanin. However, two forms are produced--pheomelanin , which is red to yellow in</span>color<span>, and eumelanin , which is dark brown to black</span>
7 0
3 years ago
Which factor makes the enzymes well suited to the role of a catalyst in a biochemical reaction?
AnnyKZ [126]

Answer: Either, B or D

Explanation:

4 0
3 years ago
Other questions:
  • You notice that some squirrels in your neighborhood have a much darker coat color than most of the other squirrels. is this dark
    15·1 answer
  • Both dna and rna are made up of building blocks known as
    15·2 answers
  • TRUE OR FALSE the oxygen present in the modern atmosphere is very reactive and would tend to destroy any new kinds of organic mo
    14·1 answer
  • What important nutrient in water is produced from photosynthesis​
    5·1 answer
  • What can be Cofactors (Biology)?
    9·2 answers
  • What is the process that is occurring from step c to step d ?
    9·2 answers
  • The number 0.00243 has how many significant digits?<br> a. 3<br> b. 4<br> c. 5<br> d. 6
    13·2 answers
  • Which is an example of commensalism in the tropical rainforest?
    7·2 answers
  • Movement of individuals into a population is referred to as:
    12·1 answer
  • Could two humans (or two cows) have some differences in their DNA sequences for insulin, yet still make the exact same insulin p
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!