1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
2 years ago
9

Predation is when a predator feeds on another organism, which is referred to as the predator's prey.

Biology
2 answers:
Alecsey [184]2 years ago
4 0

Answer:

True

Explanation:

Predation is another mechanism in which species interact with each other. Predation is when a predator organism feeds on another living organism or organisms, known as prey. The predator always lowers the prey's fitness. Also, a predator is an organism that eats another organism. The prey is the organism which the predator eats. Some examples of predator and prey are lion and zebra, bear and fish, and fox and rabbit.

Dmitrij [34]2 years ago
3 0
The answer is TRUE. Hope this helped.
You might be interested in
.They are usually found in air * True False
murzikaleks [220]

Answer:

true

Explanation:

I hope it helps

pa brainliest po

3 0
2 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
In fruit flies (drosophila melanogaster) there is a dominant allele for red eyes and a recessive allele for white eyes. these al
nataly862011 [7]
The answer is 25 percent of females are expected to be white-eyed
8 0
3 years ago
A letter about the evidence of evolution
GuDViN [60]

Answer:

I am writing this in response to a letter regarding evolution. Evolution is increasingly solid, not shaky. Darwin’s “theory” or explanation was a way of understanding what he had discovered (which did not include genes, chromosomes, DNA or nucleotide bases). Our explanations now include genetics and the commonality of mutation.  

Proofs are solid, not in question by serious scientists. Direct observation is one, which we see in the fact that this year’s flu evolved a little too far from last year’s, so flu shots are less effective this year than we would like them to be.  

Fossils tell the story well: whales with legs, dinosaurs with feathers and Tiktaalik. The latter was found in the Canadian north and is part fish, part amphibian, before there were ever any amphibians. Imperfection is a good proof: think of your useless appendix, the very bad design of your ankles, knees, and back (talk to a chiropractor about that).  You have big toes because they used to be useful thumbs for your grasping feet.

Many other animals and even plants similarly have flaws that show their evolutionary past. Two large human chromosomes reflect the coming together of two chimpanzee chromosomes each.

Hope it helps,

Please mark me as the brainliest

Thank you

5 0
2 years ago
What are the scientific goals for the Mars Science Laboratory?
Sergeeva-Olga [200]

Answer:

4

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Is neon an atom, element, molecule, or a compound?
    7·1 answer
  • An organism that makes its own food is called a
    14·2 answers
  • Which of the following is the most likely reason that a population of mice in a farming area suddenly increases.
    6·1 answer
  • Starch and water molecules in potato cells are stored in what organelle?
    8·1 answer
  • List four functions of protein
    6·2 answers
  • Which of your fossils are most likely heterotrophs? Which of them are autotrophs? How do you know?
    8·1 answer
  • A dichotomouys key is used to identify a plant. 1a. Leaves are spiny ......................Pinus taeda 1b. Leaves are broad.....
    11·1 answer
  • How do i stop my dog from whinning?
    8·1 answer
  • I’ll give a lot of points just please help and has to be the correct answer
    13·1 answer
  • Internal capsule is part of which pathway,motor or sensory?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!