1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DanielleElmas [232]
3 years ago
9

Unlike most organisms the white-tailed deer has thrived in disturbed areas. Explain at least two ways that the increasing human

population has and will continue to impact the white-tailed deer population. In your response, be sure to address both living and nonliving limiting factors.
Biology
1 answer:
Leviafan [203]3 years ago
4 0

Answer:    https://ecosystems.psu.edu/outreach/youth/sftrc/deer/wtd-lesson3

go into this link your answers is discover

Explanation:

You might be interested in
All domestic mammals have _______ cervical vertebrae.
Sauron [17]
All domestic mammals have seven cervical vertebrae.
3 0
3 years ago
Read 2 more answers
The stomata you view on the surface of the leaves are used in gas exchange and the guard cells regulate this exchange. What do y
beks73 [17]

Answer:

They will collapse and shut off the stomatal pore

Explanation:

The guard cells are regulated by the presence of water. When water is present, they become turgid and open up the stomatal pore and when water is inadequate, they become flaccid, collapse and close up the stomatal pore as a result.

<em>If the leaf is left under the microscope for too long, there will be loss of water by evapotranspiration and the guard cell will become flaccid and collapse as a result and the stomatal pore will become closed.</em>

8 0
3 years ago
Please provide a legitimate answer and provide an explanation for the question below.
UNO [17]

Answer:

The skeletal system is vital in supporting the immune system because : Bones contain marrow, a porous material which creates both white and red blood cells. This replenishment of cells allows the body to fight and expel harmful bacteria, environmental toxins,  foreign material e.t.c.

The white blood cells formed by the marrow are instrumental in isolating and destroying harmful particles (either on the site or in lymph nodes), or transporting them to the kidneys or bowels for excretion.

NOTE : Some people have marrow disorders which prevent their marrow from forming new cells; this is caused most often by cancer. Today, it is possible to transplant marrow from a healthy individual to a sick patient, and so help their bone marrow form new white and red blood cells to fight their sickness.

I hope it helps :)

6 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Why is VRBA (Violet red bile agar) only pasteurized rather than sterilized prior to use?
Georgia [21]

Answer:

Explanation:

This is because Violet and red bike is only a selective medium that detect and analyse lactose coliform microorganisms that cause fermentation and this is present in diary products like milk. This is milk use for microbiological analysis of milk because of it ability to detect lactose which is a milk sugar. There fore it cannot be use for sterilization.

4 0
3 years ago
Other questions:
  • If r-organisms reproduce at such a high rate, why don’t they usually reach their carrying capacity? If an r-population is moved
    10·1 answer
  • OPEN ENDED QUESTION
    9·2 answers
  • The cardioregulatory center of the brain is located in the
    15·1 answer
  • HELP ME PLS!!! Which determines carrying capacity? a) logistic factors b) exponential growth c) population growth d) limiting fa
    13·2 answers
  • Which of the following is true about DNA?
    9·1 answer
  • ________ adds nitrogen to the atmosphere.<br><br> Nitrogen fixation<br> Denitrification
    15·2 answers
  • What does anticipation
    12·1 answer
  • Human cells have 46 chromosomes. Each chromosome consists of a pair of identical chromatids attached together by a structure cal
    15·1 answer
  • A particularly active cell might contain large numbers of
    5·1 answer
  • How can biodiversity be protected at global level, species level and genetic level​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!