Answer:
FALSE
Explanation:
Nasal cavity is the air-filled space, present behind and above the nose. It is divided into two fossae by the nasal septum.
There are two segments of the nasal cavity : olfactory segment and respiratory segment.
The respiratory segment of the nasal cavity in lined with the ciliated pseudostratified columnar epithelium.
<u>Therefore, the given statement is FALSE.</u>
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
The one that needs help
hope that helps
Answer:
An organism’s niche is determined by its , which is it’s physical environment called Habitat.
ATP contains energy in the chemical bonds between its phosphate groups, <span>best explains how the structure of ATP helps provide energy to the cell.</span>
