1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
m_a_m_a [10]
3 years ago
13

About how much energy is transferred from a producer to a primary consumer?

Biology
1 answer:
Akimi4 [234]3 years ago
8 0

Answer:

b. 10% of the plant's energy.

Explanation:

In an ecosystem, there are various trophic levels, which form the part of the food chain. Producer like plants forms the first trophic level as they synthesize their own food via photosynthesis.

Hope it helps! ^_^

You might be interested in
Stratfied squamous epithelial tissue lines the nssal cavity.<br> a. True<br> b. False
pishuonlain [190]

Answer:

FALSE

Explanation:

Nasal cavity is the air-filled space, present behind and above the nose. It is divided into two fossae by the nasal septum.  

There are two segments of the nasal cavity : olfactory segment and respiratory segment.

The respiratory segment of the nasal cavity in lined with the ciliated pseudostratified columnar epithelium.  

<u>Therefore, the given statement is FALSE.</u>

4 0
3 years ago
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
A dependent variable is best described as
Elena L [17]
The one that needs help 
hope that helps
4 0
4 years ago
Read 2 more answers
An organisms niche is determined by it’s
Ilya [14]

Answer:

An organism’s niche is determined by its , which is it’s physical environment called Habitat.

5 0
3 years ago
Which of the following best explains how the structure of ATP helps provide energy to the cell?
Lady bird [3.3K]
ATP contains energy in the chemical bonds between its phosphate groups, <span>best explains how the structure of ATP helps provide energy to the cell.</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Locations on earth receive different amounts of sunlight based on their
    7·2 answers
  • Glucose that is not needed immediately for energy is stored in the ____________ as.
    12·1 answer
  • When do you hit puberty
    14·2 answers
  • Please help!!! Will give brainliest!!!!!!
    14·1 answer
  • Color blindness is a sex-linked recessive trait. A mother with normal color vision and a color blind father have a color blind d
    14·2 answers
  • The structure that assembles proteins in the prokaryote is the
    8·1 answer
  • The carrying capacity of the environment for a species is determined by Question 5 options: the reproductive rate of the organis
    6·2 answers
  • What would be an ethical concern associated with using an endangered Asian elephant to grow the
    15·1 answer
  • Ciclo del fosforo, la importancia
    12·1 answer
  • Middle Column says net force equation.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!