Answer:
B. only the animals living in water
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The answer is A- sperm and egg. gametes are reproductive cells in mammals, so sperm and egg would be the correct.
Answer:
Heterozygous dominant
Explanation:
because, as you know, heterozygous is different, and Dd has both dominant and recessive, making it heterozygous rather than homozygous.
Because the first d is dominant (capital D), then it makes the genotype dominant and heterozygous.
Answer:
A subkingdom of green plants that make up vegetation on earth.
Explanation:
Embryophyte is a major grouping of plants that have enclosed embryo as within a seed. They are sometimes known as land plants.
